Neoguillauminia cleopatra

(Baill.) Croizat · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Neoguillauminia

At a glance

Occurrence records62

Data sources8

Biological traits15

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Neoguillauminia cleopatra's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility62 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF62 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Neoguillauminia is a genus of plants in the family Euphorbiaceae first described as a genus in 1938.Croizat, Léon Camille Marius. 1938. Philippine Journal of Science 64: 398Tropicos, Neoguillauminia Croizat It contains only one known species, Neoguillauminia cleopatra, endemic to New Caledonia.Kew World Checklist of Selected Plant FamiliesGovaerts, R., Frodin, D.G. & Radcliffe-Smith, A. (2000). World Checklist and Bibliography of Euphorbiaceae (and Pandaceae) 1-4: 1-1622. The Board of Trustees of the Royal Botanic Gardens, Kew. Its closest relative is Calycopeplus from Australia.Horn, J. W., B. W. van Ee, J. J. Morawetz, R. Riina, V. W. Steinmann, P. E. Berry, and K. J. Wurdack. (2012) Phylogenetics and the Evolution of Major Structural Characters in the Giant Genus Euphorbia L. (Euphorbiaceae).” Molecular Phylogenetics and Evolution 63 (2): 305–26. Neoguillauminia cleopatra - MHNT

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Habitat GIFTrain forest, maquis (scrubland)

Woodinesswoody

Physiology & chemistry2

Leaf n12.5 mg/g

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neoguillauminia cleopatra has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences6

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAJ534832.1 ↗209 bpNew Caledonia

ACGT

ATCGTCGCCGCCAAACCCTGTGCCACGCAGGGGCTGGGGCGGATATTGGCCTCCCGTATGCACGTGGCTAGCGGTTGGTTCAAATGCCAG …

Neoguillauminia cleopatra ITS2, specimen voucher Morat 6651 (BR)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS4★ITS2

plant barcodefungal barcode

07Deep time~26.7 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin26.7 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type62 records

Wild obs. + sensor16

Museum / vouchered46

Range

Area of Occupancy AOO164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 3≤1 km 1≤10 km 4>10 km 2

10 georeferenced · 6 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence46

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	20
Saint Louis, US	6
Philadelphia, US	2
Zürich, CH	1

4 institutions · 29 of 46 vouchered records shown · 16 without an institution code

09Environmental DNA4 detections

Where the DNA of Neoguillauminia cleopatra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.0 °C 23.0–23.0

Seasonal swing summer↔winter6.10 °C

Max temp (day)25.7 °C

Min temp (night)20.2 °C

Precipitation155 mm/mo

Air humidity61.9 %

Moisture balance24.9 mm/mo

Vapour deficit1,073 Pa

Wind speed1.60 m/s

Cloud cover37.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)