Neofavolus alveolaris

(DC.) Sotome & T.Hatt. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Polyporales/Polyporaceae/Neofavolus

At a glance

Occurrence records5 475

Data sources8

Biological traits0

DNA specimens10

eDNA detections20

Sources8 archives

Databases and archives Neofavolus alveolaris's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 475 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 475 records

Environmental DNA2 datasets · 3 countries20 detections

DNA & barcodingBOLD · NCBI10 specimens

01Narrative

Neofavolus alveolaris is a species of polypore fungus in the family Polyporaceae. It is widely distributed in the temperate areas of the Northern Hemisphere. Its kidney- or fan-shaped fruit bodies measure 1 – in diameter. Initially reddish, they become cream to white when dry. The pores on the cap underside are angular to hexagonal and relatively large (0.5–3 mm diameter). The fungus causes a white rot in hardwoods.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neofavolus alveolaris has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes2

GenBank sequences10

eDNA detections20

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPV578070.1 ↗510 bpChina · 2020

ACGT

CTGCTCAATCCACTCTACACCTGTGCACTCATTGTGGGTTTCGGGGGGCTTTTTGCCGCTCGTACCTATGTTTATTTACAAACGCTTCAG …

Neofavolus alveolaris strain SJ1768 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type5 475 records

Wild obs. + sensor5 272

Museum / vouchered201

Other2

Range

Area of Occupancy AOO15 448 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 1 944≤1 km 638≤10 km 947>10 km 307

3 836 georeferenced · 1 436 without coordinates

Open the mapobservation + sensor5 272

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 3≤1 km 15≤10 km 113>10 km 5

136 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence201

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	18
Cincinnati, US	16
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	15
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	10
Salzburg, AT	9
WU-MYClocation not on record	9
Zürich, CH	8
Karlsruhe, DE	4
Université de Montréal Biodiversity Centrelocation not on record	4
UNINE:NEUlocation not on record	4
Chicago, US	4
KOMlocation not on record	3
Personal Herbarium of Igor Safonovlocation not on record	3
Universidade de Lisboa, Museu Bocagelocation not on record	3
TENN-Flocation not on record	3
V. N. Karazin National Universitylocation not on record	3
St. Paul, US	2
Toyota city nature sanctuarylocation not on record	2
Toronto, CA	2
CJBGlocation not on record	2
Tartu, EE	1
Ciudad de México, MX	1
Kathmandu, NP	1
San Sebastián, ES	1
Philadelphia, US	1
Odawara, JP	1

26 institutions · 130 of 201 vouchered records shown · 69 without an institution code

09Environmental DNA20 detections

Where the DNA of Neofavolus alveolaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys2

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.7 °C 0.7–14.8

Seasonal swing summer↔winter23.5 °C

Max temp (day)15.5 °C 4.70–18.6

Min temp (night)5.90 °C -3.30–9.20

Precipitation175 mm/mo 91.1–344

Air humidity58.7 % 56.0–64.9

Moisture balance56.6 mm/mo 44.7–263

Vapour deficit569 Pa 288–698

Wind speed3.10 m/s 2.90–4.20

Cloud cover43.4 % 41.8–56.9

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Neofavolus alveolaris

At a glance

Sources8 archives

At a glance

Record type5 475 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 475 records