Neoerysiphe galeopsidis

(DC.) U.Braun · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Helotiales/Erysiphaceae/Neoerysiphe

At a glance

Occurrence records4 257

Data sources7

Biological traits0

DNA specimens36

eDNA detections36

Sources7 archives

Databases and archives Neoerysiphe galeopsidis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 257 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 257 records

Environmental DNA2 datasets · 9 countries36 detections

DNA & barcodingBOLD · NCBI36 specimens

01Narrative

Hennepnetelmeeldauw is een biotrofe parasiet uit de familie Erysiphaceae die voorkomt op planten uit het de families Acanthaceae, Bignoniaceae, Lamiaceae, Malvaceae. De aandoening wordt veroorzaakt door een echte meeldauwschimmel uit het geslacht Erysiphe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neoerysiphe galeopsidis has left across the world's sequence archives.

At a glance

DNA specimens36

Marker genes2

GenBank sequences10

eDNA detections36

Countries11

The DNA barcodea real sequence read deposited for this species

ITSPV416496.1 ↗591 bpUSA · 2007

ACGT

TCATTACAGAGCGTGAGGCTCTGCCCGGCTTCCCGCCGCGCGCAGAGTCGACCCTCCACCCGTGTTAACCTATATCATGTTGCTTTGGCG …

Neoerysiphe galeopsidis voucher NCSLG17547 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type4 257 records

Wild obs. + sensor3 298

Museum / vouchered947

Other12

Origin

Native1

Range

Area of Occupancy AOO11 064 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 1 294≤1 km 215≤10 km 1 296>10 km 79

2 884 georeferenced · 414 without coordinates

Open the mapobservation + sensor3 298

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 73≤1 km 188≤10 km 104>10 km 5

370 georeferenced · 577 without coordinates

Open the institutions mapphysical evidence947

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Görlitz, DE	167
Olocation not on record	166
Helsinki, FI	120
Karlsruhe, DE	116
Tartu, EE	107
WU-MYClocation not on record	26
DPIlocation not on record	25
Mlocation not on record	21
SLU Artdatabankenlocation not on record	21
Champaign, US	21
Kew, GB	13
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	9
Bernard Price Institute for Palaeontological Researchlocation not on record	3
Museo Entomologico de Leonlocation not on record	3
Zürich, CH	2
nsnflocation not on record	2
Philadelphia, US	2
San Sebastián, ES	2
Uppsala, SE	2
Kuopio, FI	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Provincia di Livornolocation not on record	1
MeiseBGlocation not on record	1
MAlocation not on record	1
GZUlocation not on record	1
Universidade de Lisboa, Museu Bocagelocation not on record	1
Canberra, AU	1
Gijón, ES	1
Catholic University of Pekinglocation not on record	1
Pullman, US	1
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
TROMlocation not on record	1
Copenhagen, DK	1

33 institutions · 843 of 947 vouchered records shown · 74 without an institution code

09Environmental DNA36 detections

Where the DNA of Neoerysiphe galeopsidis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys2

Countries9

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.50 °C -2.50–11.0

Seasonal swing summer↔winter21.2 °C

Max temp (day)12.5 °C 0.9–14.6

Min temp (night)4.60 °C -7.30–8.20

Precipitation58.6 mm/mo 50.0–344

Air humidity60.7 % 60.2–64.9

Moisture balance-12.2 mm/mo -26.6–263

Vapour deficit482 Pa 219–544

Wind speed4.20 m/s 2.90–6.90

Cloud cover48.1 % 44.6–51.2

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Neoerysiphe galeopsidis

At a glance

Sources7 archives

At a glance

Record type4 257 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 257 records