Neocordana musae — The Life Data

Fungi/Ascomycota/Sordariomycetes/Magnaporthales/Pyriculariaceae/Neocordana

At a glance

Occurrence records3

Data sources6

Biological traits0

DNA specimens0

eDNA detections2

Sources6 archives

Databases and archives Neocordana musae's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility3 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 records

Environmental DNA2 datasets · 0 countries2 detections

DNA & barcodingNCBIsequences

01Narrative

Cordana musae is an ascomycete fungus that is a plant pathogen. It produces cordana leaf spot on bananas.Cordana leaf spot of banana produced by Cordana musae, College of Tropical Agriculture and Human Resources (CTAHR), University of Hawai'i at Mānoa, Honolulu, Hawai'i, p. 3.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neocordana musae has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPP809121.1 ↗479 bpThailand · 2021

ACGT

ATCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGAGTTGCAAAACTCCAACCCTTTGTGAACCACAACCTCCAGTCG …

Neocordana musae voucher MFLUCC 23-0248 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10

fungal barcode

08Occurrence & distribution

Record type3 records

Wild obs. + sensor2

Museum / vouchered1

Range

Area of Occupancy AOO8 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA2 detections

Where the DNA of Neocordana musae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys2

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.