Neocamarosporium betae

(Berl.) Ariyaw. & K.D.Hyde · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Pleosporales/Neocamarosporiaceae/Neocamarosporium

At a glance

Occurrence records34

Data sources9

Biological traits0

DNA specimens5

eDNA detections2

Sources9 archives

Databases and archives Neocamarosporium betae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility34 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS6 compounds

Occurrence & distributionGBIF34 records

Environmental DNA2 datasets · 2 countries2 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceGoaT · NCBI≈46 Mbp

01Narrative

Wortelbrand is een schimmelziekte, die wegval van jonge bieten- en spinazieplanten veroorzaakt. De stengel wordt bij aantasting glazig bruin en de plantjes worden slap of vallen om. Ook kan het blad aangetast worden. Er ontstaan dan grote, heldere, ronde vlekken met donkere, concentrische ringen, die bestaan uit pycnidia. Het dode weefsel wordt vaak bros. In de schimmel komen de stoffen betaenone A, B en C voor.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition6 compounds

Compounds documented for Neocamarosporium betae across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Pimarane and Isopimarane diterpenoids2

Decalins with side chains2

Aphidicolane diterpenoids $ Tetracyclic diterpenoids2

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,2S,5R,7S,10R,11R,14S,16R,17R)-17-(hydroxymethyl)-2,7,10-trimethyl-6,8-dioxapentacyclo[14.3.1.01,14.02,11.05,10]icosane-7,17-diol	present	LOTUS
(1S,2S,6R,7R,10S,12R,13R)-6-(hydroxymethyl)-2,6,13-trimethyltetracyclo[10.3.1.01,10.02,7]hexadecan-13-ol	present	LOTUS
3-Butan-2-yl-2,7-dihydroxy-7-(hydroxymethyl)-4-(3-hydroxypropanoyl)-2,4,5-trimethyl-3,4a,5,6,8,8a-hexahydronaphthalen-1-one	present	LOTUS
4-Acetyl-3-butan-2-yl-2,7-dihydroxy-2,4,5,7-tetramethyl-3,4a,5,6,8,8a-hexahydronaphthalen-1-one	present	LOTUS
Pimara-8(14),15-diene	present	LOTUS
Syn-pimaradiene	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neocamarosporium betae has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes5

GenBank sequences10

eDNA detections2

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPX971225.1 ↗507 bpCanada · 2020

ACGT

CAATAAGAAAGCGGGTGGGGAGCTACAGAAGTCGGGGCCCTCGTGGCTCTACTTCTGCCCCATCTGTCTGAATATTCACCCATGTCTTTT …

Neocamarosporium betae isolate IMSS454 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1018S28SBeta-tubulinEF1-alpha

fungal barcoderibosomalmarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Neocamarosporium betae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈45 667 487 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Neocamarosporium betae0.05 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness93.4% BUSCO

08Occurrence & distribution

Record type34 records

Wild obs. + sensor17

Museum / vouchered15

Cultivated / captive2

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy41% within 1 km

≤1 km 7≤10 km 10

17 georeferenced

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 15 records without

Open the institutions mapphysical evidence15

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	11
Helsinki, FI	1
Tromso University Museumlocation not on record	1

3 institutions · 13 of 15 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Neocamarosporium betae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.60 °C 3.60–11.6

Seasonal swing summer↔winter20.0 °C

Max temp (day)9.30 °C 5.10–13.4

Min temp (night)5.60 °C 1.30–9.90

Precipitation81.9 mm/mo 67.2–96.6

Air humidity65.2 % 63.4–67.0

Moisture balance46.5 mm/mo 17.5–75.5

Vapour deficit390 Pa 270–511

Wind speed3.10 m/s 2.80–3.30

Cloud cover45.5 % 43.0–48.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)