Neoantrodia serialiformis

(Kout & Vlasák) Audet · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Polyporales/Fomitopsidaceae/Neoantrodia

At a glance

Occurrence records37

Data sources8

Biological traits0

DNA specimens0

eDNA detections1

Sources8 archives

Databases and archives Neoantrodia serialiformis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility37 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF37 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Antrodia serialiformis is a species of polypore fungus in the family Fomitopsidaceae. The fungus is resupinate, consisting of a fertile spore-bearing pore surface lying flat on the underside of decaying wood, although one or more fan-shaped overlapping caps may also be formed. Although quite common in the eastern United States, it was not recognized as a distinct species until 2009, owing to its resemblance to the closely related Antrodia serialis. Differences in ecology, spore size, and DNA sequences distinguish the two lookalikes.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neoantrodia serialiformis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSON426361.1 ↗538 bpUSA · 2022

ACGT

TAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAATTTTGAGAGGGGTTGTAGCTGGCCGGA …

Antrodia serialiformis iNAT:109587260 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type37 records

Wild obs. + sensor28

Museum / vouchered9

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤1 km 2≤10 km 4

6 georeferenced · 22 without coordinates

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	9

1 institutions · 9 of 9 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Neoantrodia serialiformis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)