Neoalbatrellus caeruleoporus

(Peck) Audet · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Russulales/Albatrellaceae/Neoalbatrellus

At a glance

Occurrence records158

Data sources7

Biological traits0

DNA specimens3

eDNA detections3

Sources7 archives

Databases and archives Neoalbatrellus caeruleoporus's data was compiled from.

GBIFGlobal Biodiversity Information Facility158 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Chemical compositionLOTUS10 compounds

Occurrence & distributionGBIF158 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition10 compounds

Compounds documented for Neoalbatrellus caeruleoporus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Tetraketide meroterpenoids10

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
1,3-Benzenediol, 5-methyl-2-(3,7,11-trimethyl-2,6,10-dodecatrienyl)-	present	LOTUS
12-(2,6-Dihydroxy-4-methylphenyl)-2,6,10-trimethyldodeca-2,6,10-trien-4-one	present	LOTUS
4-[3-[6-(2,6-Dihydroxy-4-methylphenyl)-4-methylhex-4-enyl]-5-(2-methylprop-1-enyl)furan-2-yl]-5-hydroxy-3-methyl-6-(3,7,11-trimethyl-9-oxododeca-2,6,10-trienyl)cyclohexa-3,5-diene-1,2-dione	present	LOTUS
5-Methyl-4-(3,7,11-trimethyldodeca-2,6,10-trien-1-YL)benzene-1,3-diol	present	LOTUS
Grifolin	present	LOTUS
Grifolinone A	present	LOTUS
Grifolinone B	present	LOTUS
Neogrifolin	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neoalbatrellus caeruleoporus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences8

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKC862265.1 ↗450 bp

ACGT

CACACAAACCCCCCCTCTTGCATGTGTATCGGAACGTTCGATGTGCCACAGTGGCATATAAAATGACTTGTACAACTTTCAACGACGGAT …

Albatrellus caeruleoporus voucher DAVFP 28304 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8

fungal barcode

08Occurrence & distribution

Record type158 records

Wild obs. + sensor145

Museum / vouchered13

Range

Area of Occupancy AOO468 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 49≤1 km 28≤10 km 24>10 km 20

121 georeferenced · 24 without coordinates

Open the mapobservation + sensor145

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 1≤10 km 3

4 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Acadia Universitylocation not on record	7
Chicago, US	2
TENN-Flocation not on record	2

3 institutions · 11 of 13 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Neoalbatrellus caeruleoporus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)