Nematolepis ovatifolia

(F.Muell.) Paul G.Wilson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Nematolepis

At a glance

Occurrence records392

Data sources7

Biological traits34

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Nematolepis ovatifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility392 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Chemical compositionLOTUS · NPASS25 compounds

Occurrence & distributionGBIF392 records

DNA & barcodingNCBIsequences

01Narrative

Nematolepis ovatifolia, is a small shrub with rusty coloured scales on the stems, smooth, glossy leaves and white flowers in small clusters in summer. It is endemic to New South Wales.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology13

Fruit length3 mm

Leaf length10 mm

Leaf length max12 mm

Leaf length min9 mm

Leaf mass per area279 g/m2

Leaf size44.07 mm²

Leaf width6.5 mm

Leaf width max10 mm

Leaf width min5 mm

Plant height0.612 m

Seed mass2.86 mg

Seed mass max2.86 mg

Seed mass min2.85 mg

Life cycle & reproduction6

Dispersal typeanimal

Flowering timeyynnnnnnnnny

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf compoundnesssimple

Leaf shapewidely_elliptical

Woodinesswoody

Physiology & chemistry4

Leaf dry-matter content (LDMC)457 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)3.59 mm²/mg

03Chemical composition25 compounds

Compounds documented for Nematolepis ovatifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Steroidal alkaloids8

Kaurane and Phyllocladane diterpenoids3

Simple coumarins2

Steroidal alkaloids $ Terpenoid alkaloids1

Piperidine alkaloids $ Steroidal alkaloids1

Documented compounds25 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2S,6S,9S,10R,11S,14S,15S,17R,18S,20S,23R,24S)-6,10,23-trimethyl-4-azahexacyclo[12.11.0.02,11.04,9.015,24.018,23]pentacosane-17,20-diol	present	NPASS
(1R,6R,9S,10R,14S,15S,17R,18S,20S,23R,24S)-6,10,23-trimethyl-4-azahexacyclo[12.11.0.02,11.04,9.015,24.018,23]pentacos-2(11)-ene-17,20-diol	present	NPASS
(1S,4R,9R,10R,13R,14S)-14-(hydroxymethyl)-5,5,9-trimethyltetracyclo[11.2.1.01,10.04,9]hexadecan-14-ol	present	NPASS
(1S,4S,6R,9S,10R,13R,14R)-6-acetyloxy-5,5,9-trimethyltetracyclo[11.2.1.01,10.04,9]hexadecane-14-carboxylic acid	present	NPASS
(3S,5S,8S,9S,10R,13S,14S,17R)-3,5-dihydroxy-10,13-dimethyl-17-[(1S)-1-[(3S)-3-methyl-2,3,4,5-tetrahydropyridin-6-yl]ethyl]-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-6-one	present	NPASS
[(1S,4R,9R,10R,13R,14R)-14-hydroxy-5,5,9-trimethyl-14-tetracyclo[11.2.1.01,10.04,9]hexadecanyl]methyl (1S,4S,6R,9S,10R,13R,14R)-6-acetyloxy-5,5,9-trimethyltetracyclo[11.2.1.01,10.04,9]hexadecane-14-carboxylate	present	NPASS
Bergapten	present	LOTUS
BKMVMLLOAWNBGY-GVIYZGDLSA-N	present	NPASS
BOHSULPVIZQJSM-URTLRTLISA-N	present	NPASS
Ebeiedinone	present	NPASS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nematolepis ovatifolia has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOP524272.1 ↗759 bpAustralia

ACGT

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAATGACCCGTGAACTCAATAAAACACCTGAG …

Nematolepis ovatifolia isolate R244 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type392 records

Wild obs. + sensor276

Museum / vouchered107

Cultivated / captive8

Other1

Origin

Native34

Range

Area of Occupancy AOO340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 214≤1 km 9≤10 km 8>10 km 2

233 georeferenced · 43 without coordinates

Open the mapobservation + sensor276

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 12≤1 km 15≤10 km 61>10 km 13

101 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence107

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 6

8 georeferenced

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	34
Canberra, AU	32
Museo Entomologico de Leonlocation not on record	16
Adelaide, AU	11
Brisbane, AU	5
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Armidale, AU	3
Hobart, AU	1
John T. Waterhouse Herbariumlocation not on record	1

9 institutions · 107 of 107 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)