Nematolepis elliptica

(Paul G.Wilson) Paul G.Wilson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Nematolepis

At a glance

Occurrence records88

Data sources6

Biological traits24

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Nematolepis elliptica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility88 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF88 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaTgenome

01Narrative

Nematolepis elliptica, is a small, bushy shrub with white flowers in small clusters from September to November. It is endemic to the south coast of New South Wales.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsWCVPGIFTTRY

Size & morphology9

Fruit length3 mm

Leaf length27.5 mm

Leaf length max35 mm

Leaf length min20 mm

Leaf width11.5 mm

Leaf width max15 mm

Leaf width min8 mm

Plant height1.5 m

Plant height max1.5 m

Life cycle & reproduction3

Flowering timeyynnnnnnyyyy

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical oblong

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nematolepis elliptica has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAY631906.1 ↗606 bp

ACGT

CCTGGCCAACAGAACGACCCGTGAACTCATTAAAACACCTGAGGGGGCATGCCTTGCGTGTGCTCCTCTCCCACTCTGCCTTGGGCACAG …

Nematolepis elliptica internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceGoaT

The complete instruction manual Nematolepis elliptica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidypolyploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.996 ↗

08Occurrence & distribution

Record type88 records

Wild obs. + sensor11

Museum / vouchered77

Origin

Native20

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 7≤1 km 4

11 georeferenced

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 12≤1 km 35≤10 km 18>10 km 3

68 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence77

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	27
Mount Annan, AU	19
Museo Entomologico de Leonlocation not on record	11
NSW Dept of Planning, Industry and Environmentlocation not on record	9
Batemans Bay, AU	3
Kensington, AU	2
Brisbane, AU	2
Adelaide, AU	2
Armidale, AU	1
La Trobe Universitylocation not on record	1

10 institutions · 77 of 77 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)