Nemastoma bimaculatum

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Opiliones/Nemastomatidae/Nemastoma

At a glance

Occurrence records9 237

Data sources7

Biological traits2

DNA specimens36

eDNA detections34

Sources7 archives

Databases and archives Nemastoma bimaculatum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 237 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF9 237 records

Environmental DNA1 datasets · 4 countries34 detections

DNA & barcodingBOLD36 specimens

01Narrative

Ein Exemplar auf Totholz zwischen Asseln Der Westliche Silberfleckkanker (Nemastoma bimaculatum) ist eine Art der zu den Weberknechten gehörenden Fadenkankern und in West- und Nordeuropa beheimatet.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nemastoma bimaculatum has left across the world's sequence archives.

At a glance

DNA specimens36

BINs1

Marker genes2

eDNA detections34

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

2Tvariable

36Tmostly conserved

41Gvariable

90Cvariable

93Cvariable

131Cmostly conserved

203Tvariable

338Cvariable

438Amostly conserved

482Cmostly conserved

579Cvariable

626Gmostly conserved

CTTTATATTTTTTATTTGGTATATGAGCTGCTATATTAGGGACTGCTTTAAGAATTTTTATTCGAACAGAATTAGGACAACCTGGATCAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.73%

Haplotypes10

BIN1

Most divergent pair1.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nemastoma tristesame genus10.7%Nemastoma lugubresame genus11.1%Nemastoma dentigerumsame genus11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type9 237 records

Wild obs. + sensor8 933

Museum / vouchered304

Range

Area of Occupancy AOO19 048 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 4 409≤1 km 2 048≤10 km 2 099>10 km 7

8 563 georeferenced · 370 without coordinates

Open the mapobservation + sensor8 933

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 55≤1 km 109≤10 km 94>10 km 3

261 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence304

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	51
NTNU-VMlocation not on record	16
UMUlocation not on record	16
BioFokuslocation not on record	10
South Kensington, GB	7
Cambridge, US	4
MZLUlocation not on record	3
Natural History Museum, Londonlocation not on record	3
Ghent, BE	2
Natural History Museum Rotterdamlocation not on record	2
Helsinki, FI	1
Bonn, DE	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1

13 institutions · 117 of 304 vouchered records shown · 187 without an institution code

09Environmental DNA34 detections

Where the DNA of Nemastoma bimaculatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.2 °C 4.20–15.0

Seasonal swing summer↔winter12.1 °C

Max temp (day)13.1 °C 6.40–18.3

Min temp (night)7.10 °C 1.40–10.9

Precipitation78.2 mm/mo 61.4–171

Air humidity66.3 % 61.8–71.3

Moisture balance43.7 mm/mo -42.4–143

Vapour deficit412 Pa 250–672

Wind speed3.40 m/s 2.80–6.40

Cloud cover46.3 % 36.7–51.1

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Nemastoma bimaculatum

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type9 237 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 237 records