Nemapogon inconditella

(Lucas, 1956) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tineidae/Nemapogon

At a glance

Occurrence records161

Data sources7

Biological traits0

DNA specimens9

eDNA detections10

Sources7 archives

Databases and archives Nemapogon inconditella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility161 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF161 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD9 specimens

01Narrative

Nemapogon inconditella is a moth of the family Tineidae. It is found in most of EuropeFauna Europaea and North Africa, including Morocco. The wingspan is 12–16 mm.Hants Moths Adults are similar to Nemapogon clematella. Both species have cream-white forewings, covered with light brown scales. However, inconditella has two spots at the base of the frontal margin. Furthermore, there is a dark spot in the middle. The larvae feed on fungi, including Trametes versicolor.microlepidoptera.nl

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nemapogon inconditella has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections10

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

108Gmostly conserved

140Tmostly conserved

431Avariable

476Cvariable

537Tvariable

545Cvariable

CTTTATATTTTATTTTTGGAATTTGAGCTAGAATAGTTGGTACTTCTTTAAGAATTCTTATTCGAACAGAATTAAGAAGCCCAGGATTAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.43%

Haplotypes3

BIN1

Most divergent pair0.77%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nemapogon reisserisame genus4.3%Nemapogon signatellussame genus4.6%Nemapogon cypricasame genus5.8%Nemapogon hungaricussame genus8.0%Nemapogon granellasame genus8.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type161 records

Wild obs. + sensor110

Museum / vouchered50

Other1

Origin

Native1

Range

Area of Occupancy AOO200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 35≤1 km 5≤10 km 27

67 georeferenced · 43 without coordinates

Open the mapobservation + sensor110

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 2≤1 km 25≤10 km 13

40 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence50

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	20
Helsinki, FI	11
Tilburg, NL	7
Nijmegen, NL	6
Provincia di Livornolocation not on record	1
SLU Artdatabankenlocation not on record	1

6 institutions · 46 of 50 vouchered records shown · 4 without an institution code

09Environmental DNA10 detections

Where the DNA of Nemapogon inconditella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

edge woodland/meadowflooded meadow, salix trees

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.0 °C 18.0–23.5

Seasonal swing summer↔winter15.8 °C

Max temp (day)24.6 °C 22.1–27.3

Min temp (night)15.2 °C 12.4–19.2

Precipitation47.8 mm/mo 18.2–72.6

Air humidity57.5 % 53.6–58.9

Moisture balance-69.7 mm/mo

Vapour deficit995 Pa 902–1,255

Wind speed2.60 m/s

Cloud cover36.3 % 24.0–40.2

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)