Nemapogon defectella

(Zeller, 1873) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tineidae/Nemapogon

At a glance

Occurrence records61

Data sources7

Biological traits0

DNA specimens14

eDNA detections5

Sources7 archives

Databases and archives Nemapogon defectella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility61 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF61 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD14 specimens

01Narrative

Nemapogon defectella is a moth of the family Tineidae. It is found in North America, where it has been recorded from Arizona, California, New Hampshire and West Virginia.mothphotographersgroup

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nemapogon defectella has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.

Diversity (π)5.0%

Haplotypes2

BIN1

Most divergent pair17.5%

Where individuals differ — all 115 variable positions, in barcode order

14Amostly conserved

16Tmostly conserved

31Amostly conserved

32Amostly conserved

40Amostly conserved

43Tmostly conserved

55Amostly conserved

56Amostly conserved

69Cmostly conserved

73Amostly conserved

77Amostly conserved

81Amostly conserved

85Tmostly conserved

90Cmostly conserved

98Amostly conserved

99Amostly conserved

100Tmostly conserved

101Amostly conserved

115Cmostly conserved

119Tmostly conserved

121Amostly conserved

133Tmostly conserved

139Amostly conserved

142Tmostly conserved

161Amostly conserved

169Amostly conserved

193Tmostly conserved

202Tmostly conserved

215Gmostly conserved

216Gmostly conserved

217Amostly conserved

220Tmostly conserved

232Amostly conserved

238Amostly conserved

241Amostly conserved

256Tmostly conserved

265Cmostly conserved

271Amostly conserved

281Amostly conserved

291Tmostly conserved

292Tmostly conserved

295Amostly conserved

298Tmostly conserved

300Tmostly conserved

304Amostly conserved

305Amostly conserved

312Amostly conserved

334Amostly conserved

337Amostly conserved

349Amostly conserved

355Amostly conserved

357Amostly conserved

367Tmostly conserved

368Amostly conserved

370Amostly conserved

373Amostly conserved

374Amostly conserved

375Gmostly conserved

376Amostly conserved

379Amostly conserved

389Amostly conserved

391Amostly conserved

397Cmostly conserved

400Cmostly conserved

406Cmostly conserved

412Amostly conserved

421Amostly conserved

424Amostly conserved

436Tmostly conserved

448Cmostly conserved

451Cmostly conserved

454Amostly conserved

466Amostly conserved

467Cmostly conserved

468Gmostly conserved

473Tmostly conserved

475Tmostly conserved

476Amostly conserved

477Amostly conserved

478Tmostly conserved

482Tmostly conserved

483Cmostly conserved

487Amostly conserved

491Amostly conserved

492Tmostly conserved

494Amostly conserved

496Amostly conserved

505Amostly conserved

515Amostly conserved

518Tmostly conserved

519Tmostly conserved

526Amostly conserved

528Tmostly conserved

529Amostly conserved

530Gmostly conserved

532Amostly conserved

544Amostly conserved

547Amostly conserved

548Tmostly conserved

550Amostly conserved

553Amostly conserved

557Tmostly conserved

562Tmostly conserved

578Tmostly conserved

592Amostly conserved

595Cmostly conserved

604Amostly conserved

610Tmostly conserved

613Cmostly conserved

619Amostly conserved

620Tmostly conserved

622Amostly conserved

625Tmostly conserved

628Gmostly conserved

637Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAAGAATAGTAGGTACTTCATTAAGAATTTTAATTCGAACAGAATTAAGAAATCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nemapogon robustasame genus6.9%Nemapogon nigralbellasame genus7.0%Nemapogon granellasame genus7.0%Nemapogon angulifasciellasame genus7.0%Nemapogon koenigisame genus7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type61 records

Wild obs. + sensor26

Museum / vouchered35

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 13≤1 km 3≤10 km 5

21 georeferenced · 5 without coordinates

Open the mapobservation + sensor26

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 2≤10 km 2

4 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	20
Cornell University Insect Collectionlocation not on record	8
Smithsonian Institution, National Museum of Natural Historylocation not on record	3
Denver, US	1
San Francisco, US	1
Georgia Museum of Natural Historylocation not on record	1
ASUlocation not on record	1

7 institutions · 35 of 35 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Nemapogon defectella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

Creek bottom in oak-pinyon-juniper zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 17.4–22.5

Seasonal swing summer↔winter17.9 °C

Max temp (day)25.2 °C 24.0–28.9

Min temp (night)10.0 °C 9.90–16.5

Precipitation45.1 mm/mo 15.2–98.5

Air humidity44.6 % 41.1–52.3

Moisture balance-120 mm/mo -127–-68.1

Vapour deficit1,193 Pa 1,124–1,316

Wind speed3.20 m/s 2.10–3.20

Cloud cover21.0 % 19.3–25.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)