Nemania diffusa

(Sowerby) Gray · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Xylariales/Xylariaceae/Nemania

At a glance

Occurrence records293

Data sources10

Biological traits0

DNA specimens62

eDNA detections66

Sources10 archives

Databases and archives Nemania diffusa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility293 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI66 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics62 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF293 records

Environmental DNA4 datasets · 9 countries66 detections

DNA & barcodingBOLD · NCBI62 specimens

Genome at a glanceGoaT · NCBI≈56 Mbp

01Narrative

Nemania diffusa is a plant pathogen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding62 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nemania diffusa has left across the world's sequence archives.

At a glance

DNA specimens62

Marker genes3

GenBank sequences10

eDNA detections66

Countries10

The DNA barcodea real sequence read deposited for this species

ITSPX601479.1 ↗505 bpItaly · 2022

ACGT

CAGTGCTCGCGCCTCCCTCGTAGGCCCTACCCCGTAGGCTCCTACGCGGAAGGCGCGGGTACCCCTGCCGGTGGCCCACGAAACTCTGTC …

Nemania diffusa isolate HN15E internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1★ITS2

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Nemania diffusa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈55 636 603 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Nemania diffusa0.06 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness97.8% BUSCO

08Occurrence & distribution

Record type293 records

Wild obs. + sensor127

Museum / vouchered162

Cultivated / captive4

Range

Area of Occupancy AOO560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 80≤1 km 11≤10 km 22>10 km 6

119 georeferenced · 8 without coordinates

Open the mapobservation + sensor127

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 10≤1 km 9≤10 km 6>10 km 1

26 georeferenced · 136 without coordinates

Open the institutions mapphysical evidence162

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Copenhagen, DK	26
Pullman, US	15
Auckland, NZ	15
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	4
Kew, GB	4
National Biodiversity Institute, Costa Ricalocation not on record	3
TNMlocation not on record	3
San Sebastián, ES	2
WU-MYClocation not on record	2
Gijón, ES	1
Philadelphia, US	1
Museo Entomologico de Leonlocation not on record	1
MeiseBGlocation not on record	1
Catholic University of Pekinglocation not on record	1
HabitatVisionlocation not on record	1

15 institutions · 80 of 162 vouchered records shown · 74 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA66 detections

Where the DNA of Nemania diffusa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found66

Studies independent surveys4

Countries9

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 66 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.6 °C 12.6–28.1

Seasonal swing summer↔winter4.40 °C

Max temp (day)24.6 °C 16.8–31.9

Min temp (night)19.5 °C 7.20–23.6

Precipitation137 mm/mo 35.6–417

Air humidity66.2 % 59.8–74.1

Moisture balance-8.90 mm/mo -86.3–290

Vapour deficit737 Pa 584–1,523

Wind speed2.20 m/s 1.50–4.40

Cloud cover38.6 % 10.7–49.5

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)