Nemacladus capillaris

Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Campanulaceae/Nemacladus

At a glance

Occurrence records172

Data sources6

Biological traits14

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Nemacladus capillaris's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility172 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF172 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

Nemacladus capillaris là loài thực vật có hoa trong họ Hoa chuông. Loài này được Greene mô tả khoa học đầu tiên năm 1885.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.062 mg

Seed mass max0.062 mg

Seed mass min0.062 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nemacladus capillaris has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSOK157379.1 ↗658 bp

ACGT

GAAGATCATTGTCGAAACCTGCACAGCAGAACGACCCGCGAACCGTCAAACAACAAAACTGGGACGGAGGGCGCGGCGGACGCCCCGCGA …

Nemacladus capillaris voucher UC NRM6587 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Nemacladus capillaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 91×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Reveal, J. L. & R. Spellenberg. 1976. Miscellaneous chromosome counts of Western American plants - III. Rhodora 78: 37–52.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.928 ↗

08Occurrence & distribution

Record type172 records

Wild obs. + sensor32

Museum / vouchered140

Range

Area of Occupancy AOO520 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 20≤1 km 2>10 km 1

23 georeferenced · 9 without coordinates

Open the mapobservation + sensor32

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 3≤1 km 34≤10 km 46>10 km 1

84 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence140

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	25
Claremont, US	11
Santa Barbara, US	11
Angwin, US	9
San Luis Obispo, US	6
Davis, US	5
Canadian Department of Agriculturelocation not on record	4
Flagstaff, US	3
CASlocation not on record	3
US	3
Riverside, US	2
Arcata, US	2
San Francisco, US	2
San Diego, US	2
Pocatello, US	1
Boise, US	1
Bronx, US	1
San Jose, US	1
ASUlocation not on record	1
Orem, US	1

20 institutions · 94 of 140 vouchered records shown · 46 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)