Nemacheilus chrysolaimos

(Valenciennes, 1846) · species

image placeholder — illustration coming later

Animalia/Chordata/Cypriniformes/Nemacheilidae/Nemacheilus

At a glance

Occurrence records116

Data sources8

Biological traits4

DNA specimens99

eDNA detections122

Sources8 archives

Databases and archives Nemacheilus chrysolaimos's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility116 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI122 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics99 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF116 records

Environmental DNA1 datasets · 1 countries122 detections

DNA & barcodingBOLD99 specimens

01Narrative

Nemacheilus chrysolaimos is a species of ray-finned fish in the genus Nemacheilus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length5 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding99 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nemacheilus chrysolaimos has left across the world's sequence archives.

At a glance

DNA specimens99

BINs2

Marker genes1

eDNA detections122

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus99 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 94 variable positions, in barcode order

4Amostly conserved

13Tmostly conserved

16Cmostly conserved

25Amostly conserved

76Cmostly conserved

85Amostly conserved

97Amostly conserved

106Avariable

109Cmostly conserved

112Cmostly conserved

130Amostly conserved

160Amostly conserved

163Gmostly conserved

166Tmostly conserved

172Tvariable

175Tmostly conserved

178Gmostly conserved

181Amostly conserved

187Amostly conserved

190Cmostly conserved

199Gmostly conserved

202Gmostly conserved

205Gmostly conserved

208Amostly conserved

211Tvariable

214Gmostly conserved

238Amostly conserved

244Cmostly conserved

265Gmostly conserved

268Gmostly conserved

271Tvariable

278Cmostly conserved

280Cmostly conserved

283Gmostly conserved

284Cmostly conserved

286Tmostly conserved

295Amostly conserved

298Amostly conserved

301Tmostly conserved

307Amostly conserved

313Amostly conserved

319Gmostly conserved

322Amostly conserved

325Avariable

331Gmostly conserved

343Amostly conserved

344Cmostly conserved

346Gmostly conserved

352Amostly conserved

370Cmostly conserved

385Gmostly conserved

391Tmostly conserved

397Cmostly conserved

403Cmostly conserved

418Tmostly conserved

436Tmostly conserved

445Tmostly conserved

448Tmostly conserved

454Tmostly conserved

457Tmostly conserved

460Cmostly conserved

463Amostly conserved

484Amostly conserved

493Tmostly conserved

496Cmostly conserved

497Cmostly conserved

499Gmostly conserved

502Cmostly conserved

505Avariable

508Gmostly conserved

511Gmostly conserved

517Gmostly conserved

526Amostly conserved

529Cmostly conserved

532Tmostly conserved

538Cmostly conserved

539Cmostly conserved

541Avariable

547Cmostly conserved

553Cmostly conserved

556Gmostly conserved

559Cmostly conserved

562Tmostly conserved

565Avariable

568Tvariable

577Cmostly conserved

592Tmostly conserved

593Tmostly conserved

625Avariable

628Avariable

640Amostly conserved

643Tmostly conserved

646Gmostly conserved

652Gmostly conserved

CCTATATTTAGTTTTCGGTGCCTGAGCCGGAATAGTCGGTACCGCCCTTAGCCTTCTAATTCGAGCCGAACTAAGCCAACCAGGATCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.0%

Haplotypes19

BINs2

Most divergent pair14.4%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nemacheilus masyaesame genus8.6%Nemacheilus pallidussame genus9.4%Nemacheilus selangoricussame genus11.2%Schistura aizawlensissame family11.3%Schistura scyphovectetasame family11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type116 records

Wild obs. + sensor30

Museum / vouchered86

Range

Area of Occupancy AOO176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 15≤1 km 5>10 km 1

21 georeferenced · 9 without coordinates

Open the mapobservation + sensor30

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence86

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	2
CASlocation not on record	1

2 institutions · 3 of 86 vouchered records shown · 83 without an institution code

09Environmental DNA122 detections

Where the DNA of Nemacheilus chrysolaimos was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found122

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 122 detections have coordinates

Open the map1 country0

River

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 22.0–27.0

Seasonal swing summer↔winter2.00 °C

Max temp (day)28.2 °C 25.9–29.2

Min temp (night)21.5 °C 18.2–24.2

Precipitation288 mm/mo 187–329

Air humidity70.6 % 66.7–72.0

Moisture balance161 mm/mo 48.2–191

Vapour deficit901 Pa 769–1,182

Wind speed1.10 m/s 0.8–2.00

Cloud cover67.2 % 57.3–75.3

CHELSA 1981–2010, ~9 km grid, at location & month of 85 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)