Nelima paessleri

(Roewer, 1910) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Opiliones/Sclerosomatidae/Nelima

At a glance

Occurrence records789

Data sources7

Biological traits0

DNA specimens246

eDNA detections244

Sources7 archives

Databases and archives Nelima paessleri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility789 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI244 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics246 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF789 records

Environmental DNA1 datasets · 2 countries244 detections

DNA & barcodingBOLD246 specimens

01Narrative

Nelima paessleri is a species of harvestman in the family Sclerosomatidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding246 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nelima paessleri has left across the world's sequence archives.

At a glance

DNA specimens246

BINs3

Marker genes2

eDNA detections244

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P633 bp consensus210 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 102 variable positions, in barcode order

2Cmostly conserved

4Amostly conserved

5Tmostly conserved

6Amostly conserved

7Tmostly conserved

8Amostly conserved

9Cmostly conserved

12Amostly conserved

13Amostly conserved

16Tmostly conserved

17Tmostly conserved

18Tmostly conserved

19Gmostly conserved

20Gmostly conserved

21Cmostly conserved

23Tmostly conserved

24Tmostly conserved

25Tmostly conserved

26Gmostly conserved

27Amostly conserved

30Cmostly conserved

31Gmostly conserved

32Cmostly conserved

33Tmostly conserved

34Amostly conserved

35Tmostly conserved

38Cmostly conserved

39Amostly conserved

40Gmostly conserved

41Gmostly conserved

43Tmostly conserved

45Cmostly conserved

46Gmostly conserved

47Cmostly conserved

48Tmostly conserved

49Cmostly conserved

50Tmostly conserved

52Amostly conserved

53Gmostly conserved

55Gmostly conserved

57Tmostly conserved

58Cmostly conserved

60Gmostly conserved

61Amostly conserved

62Tmostly conserved

63Cmostly conserved

64Cmostly conserved

65Gmostly conserved

66Amostly conserved

67Amostly conserved

68Cmostly conserved

70Gmostly conserved

71Amostly conserved

73Cmostly conserved

74Tmostly conserved

75Amostly conserved

76Gmostly conserved

77Gmostly conserved

78Gmostly conserved

87Gmostly conserved

102Cmostly conserved

111Cmostly conserved

132Amostly conserved

144Tmostly conserved

162Gmostly conserved

171Cmostly conserved

177Gmostly conserved

189Amostly conserved

192Tmostly conserved

195Amostly conserved

204Cmostly conserved

222Amostly conserved

249Cmostly conserved

264Tmostly conserved

288Amostly conserved

318Amostly conserved

321Cmostly conserved

324Amostly conserved

327Gmostly conserved

336Cmostly conserved

345Amostly conserved

346Cmostly conserved

348Gmostly conserved

351Amostly conserved

360Amostly conserved

381Amostly conserved

406Tmostly conserved

432Amostly conserved

465Amostly conserved

468Cmostly conserved

480Amostly conserved

492Amostly conserved

498Tmostly conserved

513Amostly conserved

525Gmostly conserved

528Tmostly conserved

540Cmostly conserved

549Amostly conserved

567Tmostly conserved

618Tmostly conserved

624Gmostly conserved

627Amostly conserved

ACAATATACATAATTTTTGGCTTTTGAGCCGCTATAGCAGGCTCCGCTCTTAGTGTTCTGATCCGAACAGAACTAGGGCAACCAGGGTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes8

BINs3

Most divergent pair7.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Leiobunum exilipessame family6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type789 records

Wild obs. + sensor323

Museum / vouchered466

Range

Area of Occupancy AOO1 296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 165≤1 km 47≤10 km 26>10 km 20

258 georeferenced · 65 without coordinates

Open the mapobservation + sensor323

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 47≤1 km 12≤10 km 14>10 km 1

74 georeferenced · 392 without coordinates

Open the institutions mapphysical evidence466

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	157
Edmonton, CA	55
Essig Museum of Entomologylocation not on record	25
Cambridge, US	10
DOI/FWS, Kenai National Wildlife Refugelocation not on record	8
Vancouver, CA	4
Royal British Columbia Museumlocation not on record	2
University of Alaska Museumlocation not on record	2
Denver, US	1
San Diego, US	1

10 institutions · 265 of 466 vouchered records shown · 201 without an institution code

09Environmental DNA244 detections

Where the DNA of Nelima paessleri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found244

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 244 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.1. Boreal Forest1. Forest & WoodlandForestMixed HabitatMixed habitatGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.0 °C 9.70–12.8

Seasonal swing summer↔winter23.5 °C

Max temp (day)16.4 °C 14.9–18.9

Min temp (night)6.50 °C 4.00–11.1

Precipitation149 mm/mo 89.2–155

Air humidity57.2 % 53.5–64.4

Moisture balance31.9 mm/mo -19.2–45.4

Vapour deficit573 Pa 505–681

Wind speed3.00 m/s 1.60–4.60

Cloud cover33.7 % 32.9–38.7

CHELSA 1981–2010, ~9 km grid, at location & month of 241 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)