Nehalennia irene

(Hagen, 1861) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Coenagrionidae/Nehalennia

At a glance

Occurrence records9 346

Data sources10

Biological traits0

DNA specimens119

eDNA detections119

Sources10 archives

Databases and archives Nehalennia irene's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 346 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI119 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics119 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF9 346 records

Environmental DNA1 datasets · 2 countries119 detections

DNA & barcodingBOLD119 specimens

Genome at a glanceGoaT · TreeOfSex1.8 Gbp

01Narrative

The sedge sprite (Nehalennia irene) is a species of damselfly in the family Coenagrionidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding119 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nehalennia irene has left across the world's sequence archives.

At a glance

DNA specimens119

BINs1

Marker genes1

eDNA detections119

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus107 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

373Amostly conserved

619Amostly conserved

TACTCTCTATCTAATATTTGGTGCATGAGCAGGTATAGTAGGTACTGCATTAAGTATATTAATTCGAATTGAATTAGGTCAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes8

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nehalennia speciosasame genus10.3%Nehalennia integricollissame genus12.6%Epitheca costalissame order13.8%Telebasis willinkisame family14.1%Epitheca cynosurasame order14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Nehalennia irene carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 760 400 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Nehalennia irene1.76 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Chromosome records28–282n range28median28mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 285×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Animal Genome Size Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Animal Genome Size Database — ↗

TreeOfSex · invert — Cruden RW (1968) Chromosome numbers of some North American dragonflies (Odonata). Canadian Journal of Genetics and Cytology 10: 200-214. ↗

2n 272×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

08Occurrence & distribution

Record type9 346 records

Wild obs. + sensor4 628

Museum / vouchered4 718

Origin

Native3

Range

Area of Occupancy AOO15 180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 1 975≤1 km 742≤10 km 238>10 km 253

3 208 georeferenced · 1 420 without coordinates

Open the mapobservation + sensor4 628

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 94≤1 km 156≤10 km 492>10 km 496

1 238 georeferenced · 3 480 without coordinates

Open the institutions mapphysical evidence4 718

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	1 084
Montréal, CA	743
Odonata Centrallocation not on record	715
Saint John, CA	536
East Lansing, US	261
Toronto, CA	131
Université Lavallocation not on record	77
University of Guelph, Centre for Biodiversity Genomicslocation not on record	55
OSUClocation not on record	55
Vancouver, CA	37
Champaign, US	37
Cornell University Insect Collectionlocation not on record	34
Gouvernement du Québeclocation not on record	33
Cleveland Museum of Natural History, OH (CLEV)location not on record	30
New Haven, US	27
Edmonton, CA	27
University of Alberta Museums (UAM)location not on record	24
Royal Saskatchewan Museumlocation not on record	21
Biodiversity Institute of Ontariolocation not on record	13
University of Guelphlocation not on record	13
University Park, US	12
Essig Museum of Entomologylocation not on record	9
San Francisco, US	7
Chicago, US	6
Ville de Montréal, Espace pour la Vielocation not on record	6
Sam Noble Oklahoma Museum of Natural Historylocation not on record	5
Los Angeles, US	3
Albuquerque, US	3
Natural History Museum of Utahlocation not on record	2
UCBMElocation not on record	1
CASlocation not on record	1

31 institutions · 4 008 of 4 718 vouchered records shown · 710 without an institution code

09Environmental DNA119 detections

Where the DNA of Nehalennia irene was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found119

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 119 detections have coordinates

Open the map2 countries0

Riparian Zonelake edgeMeadowMixed HabitatWetlandGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 13.7–20.6

Seasonal swing summer↔winter30.2 °C

Max temp (day)22.4 °C 18.9–25.9

Min temp (night)12.8 °C 9.20–16.1

Precipitation85.9 mm/mo 74.3–102

Air humidity58.9 % 56.4–64.0

Moisture balance-48.8 mm/mo -59.8–-9.10

Vapour deficit770 Pa 667–1,037

Wind speed2.60 m/s 2.20–4.30

Cloud cover39.8 % 39.0–51.8

CHELSA 1981–2010, ~9 km grid, at location & month of 104 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Nehalennia irene

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type9 346 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 346 records