Nedra stewarti

Grote, 1875 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Nedra

At a glance

Occurrence records113

Data sources7

Biological traits0

DNA specimens13

eDNA detections14

Sources7 archives

Databases and archives Nedra stewarti's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility113 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF113 records

Environmental DNA1 datasets · 2 countries14 detections

DNA & barcodingBOLD13 specimens

01Narrative

Nedra stewarti is a moth in the family Noctuidae. It is found in California and Oregon.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nedra stewarti has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections14

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.11%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 3 variable positions, in barcode order

79Amostly conserved

194Tmostly conserved

616Cmostly conserved

AACCTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGCTTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nedra ramosulasame genus5.2%Bryophila seladonasame family6.7%Agrotis chretienisame family7.0%Bryophila tephrocharissame family7.2%Simyra dentinosasame family7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type113 records

Wild obs. + sensor33

Museum / vouchered80

Range

Area of Occupancy AOO208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 12≤1 km 4≤10 km 2>10 km 3

21 georeferenced · 12 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 8≤10 km 1>10 km 1

10 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence80

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oregon State Arthropod Collectionlocation not on record	32
Vernal, US	20
Washington, US	16
Colorado State Universitylocation not on record	8
New Haven, US	2
University of California, Davislocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

7 institutions · 80 of 80 vouchered records shown

09Environmental DNA14 detections

Where the DNA of Nedra stewarti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.9 °C 13.2–21.2

Seasonal swing summer↔winter19.0 °C

Max temp (day)27.9 °C 19.1–29.1

Min temp (night)12.4 °C 7.30–14.4

Precipitation25.3 mm/mo 7.50–92.3

Air humidity50.4 % 47.6–57.9

Moisture balance-116 mm/mo -168–-27.5

Vapour deficit1,192 Pa 690–1,262

Wind speed2.40 m/s 2.00–3.10

Cloud cover35.2 % 27.2–47.2

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)