Nectomys rattus

(Pelzeln, 1883) · species

image placeholder — illustration coming later

Animalia/Chordata/Mammalia/Rodentia/Cricetidae/Nectomys

At a glance

Occurrence records143

Data sources6

Biological traits16

DNA specimens8

eDNA detections0

Sources6 archives

Databases and archives Nectomys rattus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility143 records↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF143 records

DNA & barcodingBOLD8 specimens

01Narrative

Nectomys rattus, the small-footed bristly mouse, Amazonian nectomys, Amazonian mouse,Musser and Carleton, 2005 or common water rat is a species of rodent in the genus Nectomys of family Cricetidae. It is found in Brazil, Colombia, French Guiana, Guyana, Suriname, and Venezuela, where it lives in a variety of habitats including lowland tropical rainforest, cerrado and caatinga. It is mainly found in areas close to water. It was recognized as distinct only in 2000 and its limits with other Nectomys, including Nectomys apicalis and Nectomys squamipes, remain unclear.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPanTHERIAAmnioteDBEltonTraits

Size & morphology2

Body mass249 g

SVL24.5 cm

Life cycle & reproduction2

Litter size4.5

Max. longevity31.9 months

Diet & foraging6

Breadth3

Fish20 %

Invertebrate30 %

Plant other30 %

Trophic levelomnivore

Vertebrate ectotherm20 %

Habitat & environment2

Habitat breadth1

Terrestriality1.00

Physiology & chemistry2

Precipitation mean308 mm

Temperature mean243 decidegC

Other traits2

Activity cycle1.00

Foraging stratumG

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nectomys rattus has left across the world's sequence archives.

At a glance

DNA specimens8

BINs3

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P622 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 28 variable positions, in barcode order

4Gmostly conserved

7Avariable

28Cmostly conserved

40Avariable

49Amostly conserved

70Tmostly conserved

118Tmostly conserved

121Cmostly conserved

133Avariable

151Gmostly conserved

178Amostly conserved

202Tvariable

214Cvariable

232Amostly conserved

241Cvariable

352Cvariable

364Cvariable

400Amostly conserved

448Gvariable

496Tmostly conserved

517Tmostly conserved

538Tmostly conserved

550Tmostly conserved

565Tvariable

571Gmostly conserved

574Cvariable

592Amostly conserved

598Gmostly conserved

CATGGTAGGCACAGCCCTCAGCATCATCATCCGAGCTGAACTAGGCCAACCAGGCACTCTCCTCGGAGATGACCAAATTTACAACGTAGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes6

BINs3

Most divergent pair3.2%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nectomys squamipessame genus2.3%Melanomys caliginosussame family13.0%Oecomys trinitatissame family14.1%Euryoryzomys macconnellisame family14.1%Peromyscus simulussame family14.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type143 records

Wild obs. + sensor10

Museum / vouchered133

Origin

Native2

Range

Area of Occupancy AOO216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤1 km 3≤10 km 1>10 km 3

7 georeferenced · 3 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤100 m 9≤1 km 37≤10 km 3>10 km 2

51 georeferenced · 82 without coordinates

Open the institutions mapphysical evidence133

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	49
Geneva, CH	40
UFSMlocation not on record	13
Washington, US	11
Universidad de Caldas (UCaldas)location not on record	5
UFESlocation not on record	4
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	3
University of Wisconsin, Zoological Museumlocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Ann Arbor, US	2
UEGlocation not on record	1

11 institutions · 132 of 133 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)