Necrophilus hydrophiloides

Guérin-Méneville, 1834 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Agyrtidae/Necrophilus

At a glance

Occurrence records532

Data sources6

Biological traits0

DNA specimens24

eDNA detections23

Sources6 archives

Databases and archives Necrophilus hydrophiloides's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility532 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF532 records

Environmental DNA1 datasets · 2 countries23 detections

DNA & barcodingBOLD24 specimens

01Narrative

Necrophilus hydrophiloides, the flat brown scavenger beetle, is a species of primitive carrion beetle in the family Agyrtidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Necrophilus hydrophiloides has left across the world's sequence archives.

At a glance

DNA specimens24

BINs1

Marker genes1

eDNA detections23

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

5Gmostly conserved

44Amostly conserved

209Amostly conserved

233Cvariable

371Amostly conserved

498Tmostly conserved

620Amostly conserved

626Gvariable

629Avariable

635Tmostly conserved

655Tmostly conserved

CATTGTATTTTATTTTTGGTGCCTGAGCAGGAATAGTCGGGACATCATTAAGAATTTTAATTCGAGCAGAACTTGGAAACCCCGGTACAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.63%

Haplotypes5

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Quedius canadensissame order13.3%Eusphalerum farraraesame order14.0%Pogonus cardiotrachelussame order14.8%Pogonistes gracilissame order15.0%Chrysobothris adelphasame order15.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type532 records

Wild obs. + sensor417

Museum / vouchered115

Range

Area of Occupancy AOO1 220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 264≤1 km 25≤10 km 23>10 km 31

343 georeferenced · 74 without coordinates

Open the mapobservation + sensor417

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 24≤1 km 11≤10 km 1>10 km 4

40 georeferenced · 75 without coordinates

Open the institutions mapphysical evidence115

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	56
ASUlocation not on record	17
Edmonton, CA	15
OSUClocation not on record	9
Chicago, US	4
San Francisco, US	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Chicago, US	2
Royal British Columbia Museumlocation not on record	1
EWIClocation not on record	1

10 institutions · 110 of 115 vouchered records shown · 5 without an institution code

09Environmental DNA23 detections

Where the DNA of Necrophilus hydrophiloides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map2 countries0

lowland conifer forest, beach edge; Elymus, …lowland conifer forest/beach edgeforest, 2nd growth

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.1 °C 9.20–15.2

Seasonal swing summer↔winter10.2 °C

Max temp (day)13.7 °C 11.8–20.0

Min temp (night)7.80 °C 5.10–10.7

Precipitation93.0 mm/mo 25.4–267

Air humidity61.4 % 48.9–70.2

Moisture balance30.9 mm/mo -118–179

Vapour deficit476 Pa 397–846

Wind speed3.30 m/s 1.80–5.40

Cloud cover43.2 % 30.5–52.1

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)