Necrophila americana

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Staphylinidae/Necrophila

At a glance

Occurrence records16 653

Data sources11

Biological traits0

DNA specimens49

eDNA detections36

Sources11 archives

Databases and archives Necrophila americana's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility16 653 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS10 compounds

Occurrence & distributionGBIF16 653 records

Environmental DNA1 datasets · 2 countries36 detections

DNA & barcodingBOLD49 specimens

Genome at a glanceGoaT · TreeOfSex2n = 40

01Narrative

The American carrion beetle (Necrophila americana,Species Necrophila americana - American Carrion Beetle: http://bugguide.net/node/view/6744 formerly Silpha americana) is a North American beetle of the family Silphidae. It lays its eggs in, and its larvae consume, raw flesh (particularly that of dead animals) and fungi. The larvae and adults also consume fly larvae and the larvae of other carrion beetles that compete for the same food sources as its larvae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition10 compounds

Compounds documented for Necrophila americana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Halogenated hydrocarbons4

Pregnane steroids1

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,3R)-1,3-dibromo-1,3-dichloropropan-2-one	present	NPASS
1,1,3,3-Tetrabromoacetone	present	NPASS
15-beta-Hydroxyprogesterone	present	LOTUS
3-Bromo-1,1-dichloropropan-2-one	present	NPASS
Bromoform	present	NPASS
FNYCCOFOQIUTIM-UHFFFAOYSA-N	present	NPASS
GNWZITBRPXAMSE-UHFFFAOYSA-N	present	NPASS
LQQKDSXCDXHLLF-UHFFFAOYSA-N	present	NPASS
XKPSFUWXVLJUDU-GSVOUGTGSA-N	present	NPASS
ZABBFAHZPHMIJC-UHFFFAOYSA-N	present	NPASS

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Necrophila americana has left across the world's sequence archives.

At a glance

DNA specimens49

BINs1

Marker genes12

eDNA detections36

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P643 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 31 variable positions, in barcode order

7Amostly conserved

10Tmostly conserved

95Cmostly conserved

112Amostly conserved

187Tmostly conserved

379Tmostly conserved

469Avariable

571Tmostly conserved

612Tmostly conserved

613Cmostly conserved

614Gmostly conserved

615Amostly conserved

619Cmostly conserved

620Gmostly conserved

621Cmostly conserved

624Gmostly conserved

625Amostly conserved

627Gmostly conserved

628Tmostly conserved

630Gmostly conserved

631Amostly conserved

632Gmostly conserved

633Amostly conserved

634Tmostly conserved

636Cmostly conserved

637Gmostly conserved

638Gmostly conserved

640Tmostly conserved

641Cmostly conserved

642Tmostly conserved

643Amostly conserved

TACCCTATATTTCATTTTTGGGACCTGGGCTGGAATAGTAGGTATATCCTTAAGAATTTTGATTCGTATAGAACTAGGAACTCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes7

BIN1

Most divergent pair5.0%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dendroxena quadrimaculatasame family14.5%Silpha tristissame family14.9%Aclypea opacasame family14.9%Oiceoptoma inaequalesame family14.9%Oiceoptoma thoracicumsame family15.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_018352 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1l-rRNAs-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Necrophila americana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Chromosome records40–402n range40median40mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 404×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Vorontosov NN, Yadav JS, Lyapunova EA, Korablev VP, Yanina IY (1984) Comparative karyology of seven species of staphylinoid beetles (Polyphaga: Coleoptera). Genetica 63.2: 153-159. ↗

08Occurrence & distribution

Record type16 653 records

Wild obs. + sensor12 614

Museum / vouchered4 039

Range

Area of Occupancy AOO39 208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 6 958≤1 km 1 756≤10 km 871>10 km 1 125

10 710 georeferenced · 1 904 without coordinates

Open the mapobservation + sensor12 614

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 26≤1 km 53≤10 km 142>10 km 36

257 georeferenced · 3 782 without coordinates

Open the institutions mapphysical evidence4 039

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WIlocation not on record	2 346
Chicago, US	745
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	186
Wuzhou, CN	120
Sam Noble Oklahoma Museum of Natural Historylocation not on record	105
OSUClocation not on record	98
College Station, US	66
Lexington, US	61
University of Guelphlocation not on record	52
New Haven, US	40
CUlocation not on record	35
Toronto, CA	23
Cambridge, US	22
Saint John, CA	18
University of Central Floridalocation not on record	15
University of Guelph, Centre for Biodiversity Genomicslocation not on record	11
Denver, US	8
University Park, US	8
Lubbock, US	7
North Carolina State University Insect Museumlocation not on record	7
US	7
Mississippi State, US	5
San Francisco, US	5
SOVTlocation not on record	5
Centre for Biodiversity Genomicslocation not on record	5
Cornell University Insect Collectionlocation not on record	4
Champaign, US	4
MAJClocation not on record	3
Montgomery, US	2
Biodiversity Institute of Ontariolocation not on record	2
Philadelphia, US	2
UDlocation not on record	2
Espace pour la vielocation not on record	1
Chicago, US	1
East Lansing, US	1
EWIClocation not on record	1

36 institutions · 4 023 of 4 039 vouchered records shown · 16 without an institution code

09Environmental DNA36 detections

Where the DNA of Necrophila americana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map2 countries0

1. Forest & WoodlandRiparian ZoneForest1. Forest & Woodland|1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.4 °C 13.3–21.4

Seasonal swing summer↔winter27.5 °C

Max temp (day)24.2 °C 18.9–26.2

Min temp (night)15.5 °C 10.1–19.9

Precipitation92.9 mm/mo 80.5–106

Air humidity59.8 % 58.0–61.8

Moisture balance-40.8 mm/mo -81.8–24.0

Vapour deficit917 Pa 682–1,066

Wind speed3.20 m/s 2.60–7.10

Cloud cover42.7 % 36.4–50.8

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Necrophila americana

At a glance

Sources11 archives

Compound class profile2 classes

Documented compounds10 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type16 653 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type16 653 records