Nebulatettix subgracilis

(Caudell, 1903) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Acrididae/Nebulatettix

At a glance

Occurrence records413

Data sources8

Biological traits0

DNA specimens11

eDNA detections9

Sources8 archives

Databases and archives Nebulatettix subgracilis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility413 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF413 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD11 specimens

01Narrative

Nebulatettix subgracilis, the Southwestern Dusky Grasshopper, is a species of band-winged grasshopper in the family Acrididae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nebulatettix subgracilis has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.6%

Haplotypes2

BIN1

Most divergent pair2.3%

Where individuals differ — all 17 variable positions, in barcode order

13Tvariable

19Tvariable

25Avariable

74Cvariable

136Tmostly conserved

157Tmostly conserved

235Cmostly conserved

278Cmostly conserved

305Gmostly conserved

358Gvariable

376Cmostly conserved

469Gvariable

536Cvariable

539Cvariable

556Amostly conserved

568Gvariable

634Cvariable

CACTTTATATTTTATATTTGGAGCATGAGCCGGAATAGTAGGAACATCAATAAGAATAATTATTCGTGCTGAACTAGGACAACCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Encoptolophus costalissame family7.0%Chortophaga viridifasciatasame family7.3%Chortophaga australiorsame family7.4%Acrolophitus hirtipessame family9.3%Aulocara elliottisame family9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type413 records

Wild obs. + sensor393

Museum / vouchered20

Range

Area of Occupancy AOO972 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 184≤1 km 99≤10 km 25>10 km 33

341 georeferenced · 52 without coordinates

Open the mapobservation + sensor393

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤1 km 6≤10 km 11

17 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	18
College Station, US	1
Centre for Biodiversity Genomicslocation not on record	1

3 institutions · 20 of 20 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Nebulatettix subgracilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.2 °C 15.2–30.5

Seasonal swing summer↔winter18.9 °C

Max temp (day)32.6 °C 23.2–37.5

Min temp (night)21.4 °C 8.40–23.8

Precipitation36.2 mm/mo 3.00–73.5

Air humidity45.7 % 42.2–53.8

Moisture balance-158 mm/mo -194–-84.7

Vapour deficit1,648 Pa 992–2,454

Wind speed3.00 m/s 2.20–4.50

Cloud cover20.6 % 17.0–30.8

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)