Nebria salina

Fairmaire & Laboulbène, 1854 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Nebria

At a glance

Occurrence records8 721

Data sources8

Biological traits0

DNA specimens11

eDNA detections10

Sources8 archives

Databases and archives Nebria salina's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 721 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF8 721 records

Environmental DNA1 datasets · 3 countries10 detections

DNA & barcodingBOLD11 specimens

Genome at a glanceGoaT · NCBI≈257 Mbp

01Narrative

Nebria salina is a species of ground beetle native to Europe.Fauna EuropaeaCarl H. Lindroth 1974 Coleoptera. Carabidae. Handbooks for the Identification of British Insects Vol 4 Part 2. Royal Entomological Society,London pdf

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nebria salina has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes2

eDNA detections10

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

22Amostly conserved

25Cmostly conserved

78Gmostly conserved

79Amostly conserved

80Amostly conserved

81Amostly conserved

127Tmostly conserved

328Gmostly conserved

373Amostly conserved

559Gvariable

599Amostly conserved

AACTTTATATTTTATTTTTGGAGCCTGAGCAGGAATAGTAGGAACTTCATTAAGAATATTAATTCGGGCAGAATTAGGAAACCCGGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.43%

Haplotypes6

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nebria brevicollissame genus5.2%Nebria tibialissame genus9.0%Nebria rubripessame genus9.6%Nebria hellwigiisame genus10.3%Nebria hudsonicasame genus11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Nebria salina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈256 715 385 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Nebria salina0.26 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 421×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.8% BUSCO

08Occurrence & distribution

Record type8 721 records

Wild obs. + sensor7 293

Museum / vouchered1 395

Fossil31

Other2

Origin

Native1 082

Range

Area of Occupancy AOO10 944 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 2 682≤1 km 1 326≤10 km 3 083>10 km 32

7 123 georeferenced · 170 without coordinates

Open the mapobservation + sensor7 293

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 200≤1 km 366≤10 km 754>10 km 24

1 344 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence1 395

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vitoria, ES	229
HAFLlocation not on record	112
Trondheim, NO	86
SLU Artdatabankenlocation not on record	83
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	63
Zürich, CH	57
Forschungsinstitut für biologischen Landbau Frick \| Research Institute of Organic Agriculture Fricklocation not on record	46
Natural History Museum Rotterdamlocation not on record	38
Musee d'Histoire Naturallelocation not on record	26
NTNU-VMlocation not on record	26
ZAF-UMUlocation not on record	24
Ghent, BE	19
Tilburg, NL	18
Copenhagen, DK	10
Bern, CH	8
Leuphanalocation not on record	7
NMOKlocation not on record	6
Nijmegen, NL	6
ZSMlocation not on record	6
CBDClocation not on record	4
Paro, BT	4
neflocation not on record	3
BioFokuslocation not on record	3
Uniwersytet Wrocławskilocation not on record	3
Tromsø, NO	2
Naturmuseum Solothurnlocation not on record	2
GMBRClocation not on record	2
EIBElocation not on record	2
LEBAlocation not on record	2
Tartu, EE	2
EWIClocation not on record	1
Helsinki, FI	1
LSMlocation not on record	1
NHMOlocation not on record	1
NCMGlocation not on record	1
Olocation not on record	1

36 institutions · 905 of 1 395 vouchered records shown · 490 without an institution code

09Environmental DNA10 detections

Where the DNA of Nebria salina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 6.80–16.3

Seasonal swing summer↔winter16.3 °C

Max temp (day)17.4 °C 10.3–20.2

Min temp (night)8.70 °C 3.40–11.6

Precipitation69.9 mm/mo 56.8–78.9

Air humidity59.8 % 58.6–64.4

Moisture balance-33.9 mm/mo -40.7–26.2

Vapour deficit641 Pa 379–758

Wind speed2.90 m/s 2.70–4.20

Cloud cover37.4 % 32.9–46.7

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Nebria salina

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type8 721 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 721 records