Nebria ovipennis

LeConte, 1878 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Nebria

At a glance

Occurrence records133

Data sources7

Biological traits0

DNA specimens33

eDNA detections2

Sources7 archives

Databases and archives Nebria ovipennis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility133 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF133 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD33 specimens

01Narrative

Nebria ovipennis is a species of ground beetle in the Nebriinae subfamily that is endemic to the US state of California.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nebria ovipennis has left across the world's sequence archives.

At a glance

DNA specimens33

BINs1

Marker genes2

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P463 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

7Amostly conserved

13Avariable

22Cmostly conserved

34Amostly conserved

40Cmostly conserved

88Tmostly conserved

106Cmostly conserved

130Cmostly conserved

152Tmostly conserved

196Cvariable

295Cvariable

316Amostly conserved

430Amostly conserved

442Tmostly conserved

ATTAGTACCTTTAATACTAGGCGCTCCTGATATAGCATTCCCACGAATAAATAATATAAGATTTTGACTTCTACCCCCATCTTTATCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.94%

Haplotypes20

BIN1

Most divergent pair2.4%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nebria kincaidisame genus6.7%Nebria sajanasame genus7.1%Nebria vandykeisame genus8.0%Nebria meanyisame genus8.0%Nebria paradisisame genus8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type133 records

Museum / vouchered133

Range

Area of Occupancy AOO108 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 1≤10 km 2>10 km 2

5 georeferenced · 128 without coordinates

Open the institutions mapphysical evidence133

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Francisco, US	114
Santa Barbara Museum of Natural Historylocation not on record	8
OSUClocation not on record	4
Provo, US	2
Cambridge, US	2
Zürich, CH	1

6 institutions · 131 of 133 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Nebria ovipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median2.30 °C 2.30–2.30

Seasonal swing summer↔winter20.3 °C

Max temp (day)8.50 °C

Min temp (night)-3.40 °C

Precipitation100 mm/mo

Air humidity50.3 %

Moisture balance-1.90 mm/mo

Vapour deficit422 Pa

Wind speed5.30 m/s

Cloud cover37.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)