Nebria jockischii

Sturm, 1815 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Nebria

At a glance

Occurrence records422

Data sources5

Biological traits0

DNA specimens22

eDNA detections19

Sources5 archives

Databases and archives Nebria jockischii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility422 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF422 records

Environmental DNA1 datasets · 2 countries19 detections

DNA & barcodingBOLD22 specimens

01Narrative

Nebria jockischii is een keversoort uit de familie van de loopkevers (Carabidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1815 door Sturm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nebria jockischii has left across the world's sequence archives.

At a glance

DNA specimens22

BINs3

Marker genes3

eDNA detections19

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

19Cmostly conserved

34Amostly conserved

40Amostly conserved

52Gmostly conserved

82Tmostly conserved

92Cvariable

106Cvariable

197Tmostly conserved

202Amostly conserved

217Avariable

271Cvariable

280Gmostly conserved

298Amostly conserved

328Amostly conserved

364Tmostly conserved

373Amostly conserved

400Cmostly conserved

421Amostly conserved

535Amostly conserved

574Tvariable

625Amostly conserved

646Tvariable

AACTTTATATTTTATTTTCGGAGCTTGAGCTGGAATAGTAGGAACTTCTTTGAGAATATTAATTCGAGCCGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes9

BINs3

Most divergent pair6.2%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nebria picicornissame genus4.6%Nebria psammodessame genus5.6%Nebria charlottaesame genus9.7%Nebria vandykeisame genus10.3%Platyderus depressussame family10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type422 records

Wild obs. + sensor282

Museum / vouchered118

Other22

Range

Area of Occupancy AOO892 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy27% within 1 km

≤100 m 39≤1 km 22≤10 km 152>10 km 16

229 georeferenced · 53 without coordinates

Open the mapobservation + sensor282

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 3≤1 km 19≤10 km 58>10 km 1

81 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence118

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Salzburg, AT	41
Natural History Museum Rotterdamlocation not on record	13
European Distributed Institute of Taxonomy (EDIT)location not on record	9
Adam Mickiewicz University in Poznańlocation not on record	9
Uniwersytet Wrocławskilocation not on record	8
ZSMlocation not on record	7
NMOKlocation not on record	2
South Kensington, GB	1

8 institutions · 90 of 118 vouchered records shown · 27 without an institution code

09Environmental DNA19 detections

Where the DNA of Nebria jockischii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.10 °C -3.40–14.0

Seasonal swing summer↔winter19.3 °C

Max temp (day)11.4 °C 0.2–18.7

Min temp (night)2.00 °C -8.30–8.60

Precipitation183 mm/mo 154–251

Air humidity64.7 % 59.8–65.0

Moisture balance128 mm/mo 44.0–160

Vapour deficit355 Pa 212–566

Wind speed4.80 m/s 3.80–6.00

Cloud cover36.6 % 35.8–47.0

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)