Nebria germarii

Heer, 1837 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Nebria

At a glance

Occurrence records65

Data sources7

Biological traits0

DNA specimens11

eDNA detections6

Sources7 archives

Databases and archives Nebria germarii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility65 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF65 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD11 specimens

01Narrative

Nebria germarii is a species of ground beetle in the Nebriinae subfamily that can be found in Austria, Germany, Italy, Liechtenstein, Switzerland, and in every state of former Yugoslavia, except for North Macedonia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nebria germarii has left across the world's sequence archives.

At a glance

DNA specimens11

BINs4

Marker genes3

eDNA detections6

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

40Amostly conserved

43Gmostly conserved

85Tmostly conserved

148Avariable

175Amostly conserved

190Gvariable

206Tmostly conserved

313Tmostly conserved

328Gmostly conserved

346Tmostly conserved

373Avariable

400Cvariable

421Tvariable

433Avariable

454Tvariable

466Amostly conserved

493Amostly conserved

541Amostly conserved

568Tmostly conserved

577Gmostly conserved

616Cmostly conserved

622Avariable

634Cmostly conserved

640Cmostly conserved

TACTTTATATTTTATTTTTGGAGCATGGGCAGGAATAGTAGGGACTTCATTAAGAATACTGATCCGAGCAGAATTAGGAAACCCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes4

BINs4

Most divergent pair2.6%

OtherEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nebria hellwigiisame genus7.3%Nebria charlottaesame genus10.9%Sirdenus grayiisame family10.9%Gnathaphanus philippensissame family11.4%Nebria haidasame genus11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type65 records

Wild obs. + sensor16

Museum / vouchered47

Other2

Range

Area of Occupancy AOO144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 11≤1 km 1≤10 km 3

15 georeferenced · 1 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 18≤10 km 9

27 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Salzburg, AT	25
Natural History Museum Rotterdamlocation not on record	2
Zürich, CH	1
SNSB-Zoologische Staatssammlung Münchenlocation not on record	1

4 institutions · 29 of 47 vouchered records shown · 18 without an institution code

09Environmental DNA6 detections

Where the DNA of Nebria germarii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.0 °C 20.0–20.0

Seasonal swing summer↔winter20.2 °C

Max temp (day)23.1 °C

Min temp (night)14.7 °C

Precipitation145 mm/mo

Air humidity61.3 %

Moisture balance5.60 mm/mo

Vapour deficit901 Pa

Wind speed1.50 m/s

Cloud cover37.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)