Naohidea sebacea

(Berk. & Broome) Oberw. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Cystobasidiomycetes/Naohideales/Naohideaceae/Naohidea

At a glance

Occurrence records177

Data sources8

Biological traits0

DNA specimens1

eDNA detections136

Sources8 archives

Databases and archives Naohidea sebacea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility177 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI136 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF177 records

Environmental DNA4 datasets · 2 countries136 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceNCBI≈20 Mbp

01Narrative

Naohidea sebacea Oberw – gatunek grzybów z rzędu Naohideales.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Naohidea sebacea has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

eDNA detections136

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOK039352.1 ↗533 bpUkraine · 2019

ACGT

TTTCGAGACCCGACTCTCATATATTAACCCAGTGAACTAAACTTTTTTTCATTTTAAACACTGTAAAGTCTTTGGATGTAAATAGCTTGT …

Naohidea sebacea voucher CWU(MYC)AB412 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceNCBI

The complete instruction manual Naohidea sebacea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈20 431 960 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Naohidea sebacea0.02 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type177 records

Wild obs. + sensor20

Museum / vouchered156

Cultivated / captive1

Range

Area of Occupancy AOO416 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 18>10 km 1

19 georeferenced · 1 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 155 without coordinates

Open the institutions mapphysical evidence156

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	4
Mlocation not on record	2
Gijón, ES	1
Vancouver, CA	1

4 institutions · 8 of 156 vouchered records shown · 147 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA136 detections

Where the DNA of Naohidea sebacea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found136

Studies independent surveys4

Countries2

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 136 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature16.0 °C 7.00–25.0

pH5.70 4.10–8.60

Conductivity59.9 µS/cm 13.0–432

Organic carbon2.69 % 0.004–5.22

Water content9.73 % 1.45–24.3

Nitrate-N8.00 mg/kg 0.122–209

Phosphorus15.0 mg/kg 2.00–214

Clay15.6 % 1.91–41.1

Sand70.3 % 25.8–94.1

Depth0 m 0–0.2

SoilChromosolsKandosolRudosolTenosolsSodosolFerrosol

124 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 12.7–21.9

Seasonal swing summer↔winter10.9 °C

Max temp (day)19.4 °C 16.6–27.2

Min temp (night)10.4 °C 8.20–16.4

Precipitation55.7 mm/mo 34.5–90.7

Air humidity56.7 % 54.8–59.2

Moisture balance-67.3 mm/mo -105–-24.5

Vapour deficit735 Pa 622–1,157

Wind speed3.20 m/s 2.40–4.10

Cloud cover25.2 % 15.5–40.0

CHELSA 1981–2010, ~9 km grid, at location & month of 134 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)