Nannoleon michaelseni

Esben-Petersen, 1928 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Neuroptera/Myrmeleontidae/Nannoleon

At a glance

Occurrence records183

Data sources8

Biological traits0

DNA specimens4

eDNA detections3

Sources8 archives

Databases and archives Nannoleon michaelseni's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility183 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF183 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD4 specimens

01Narrative

Nannoleon is a genus of antlions in the insect family Myrmeleontidae in the order Neuroptera. It comprises a single species, Nannoleon michaelseni, which is found in Namibia and South Africa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nannoleon michaelseni has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

4Avariable

85Avariable

217Gvariable

247Cvariable

265Gvariable

358Tvariable

517Tvariable

547Gvariable

562Gvariable

578Cvariable

637Tvariable

ATTATATTTCGTATTTGGAATTTGAGCTGGATTAGTAGGTACAAGATTAAGCTTACTAATTCGAGCAGAACTTGGTCAACCAGGATCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes3

BIN1

Most divergent pair1.4%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Megistopus flavicornissame family14.9%Libelloides longicornissame family15.8%Brachynemurus sackenisame family15.9%Libelloides coccajussame family15.9%Apertochrysa pictetisame order16.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type183 records

Wild obs. + sensor17

Museum / vouchered166

Range

Area of Occupancy AOO260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 5

8 georeferenced · 9 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 166 records without

Open the institutions mapphysical evidence166

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
College Station, US	81
Agricultural Research Council-Plant Protection Research Institutelocation not on record	56
Transvaal Museumlocation not on record	19
Washington, US	8
CCSAlocation not on record	1

5 institutions · 165 of 166 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Nannoleon michaelseni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

2. Savanna | 2.1. Dry SavannaMopane Shrubveld

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 24.0–25.8

Seasonal swing summer↔winter9.30 °C

Max temp (day)30.2 °C 29.0–30.3

Min temp (night)19.4 °C 18.7–20.6

Precipitation51.3 mm/mo 27.1–71.8

Air humidity54.3 % 54.0–55.2

Moisture balance-102 mm/mo -105–-99.6

Vapour deficit1,487 Pa 1,375–1,498

Wind speed2.70 m/s 2.70–3.00

Cloud cover36.0 % 22.2–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)