Myxotrichum chartarum

Kunze · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Helotiales/Myxotrichaceae/Myxotrichum

At a glance

Occurrence records69

Data sources7

Biological traits0

DNA specimens0

eDNA detections1

Sources7 archives

Databases and archives Myxotrichum chartarum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility69 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF69 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Myxotrichum chartarum is a psychrophilic and cellulolytic fungus first discovered in Germany by Gustav Kunze in 1823. Its classification has changed many times over its history to better reflect the information available at the time. Currently, M. chartarum is known to be an ascomycete surrounded by a gymnothecium composed of ornate spines and releases asexual ascospores. The presence of cellulolytic processes are common in fungi within the family Myxotrichaceae. M. chartarum is one of many Myxotrichum species known to degrade paper and paper products. Evidence of M. chartarum "red spot" mold formation, especially on old books, can be found globally. As a result, this fungal species and other cellulolytic molds are endangering old works of art and books. Currently, there is no evidence that suggests that species within the family Myxotrichaceae are pathogenic.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition1 compounds

Compounds documented for Myxotrichum chartarum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Miscellaneous polyketides1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Patulin		present	LOTUS

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Myxotrichum chartarum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF062813.1 ↗526 bp

ACGT

CATTACAGAGTTCGCGCCCTTTACGGGTAGATCTCCCACCCTGTGTTATCGCTACCGCGTTGCTTTGGCGGGCCGCTAGGCTCCAGCCTG …

Myxotrichum chartarum 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type69 records

Wild obs. + sensor7

Museum / vouchered61

Other1

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy14% within 1 km

≤100 m 1≤10 km 6

7 georeferenced

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 1≤1 km 6≤10 km 14>10 km 1

22 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence61

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	8
FLASlocation not on record	3
PHlocation not on record	2
Chicago, US	1
Pullman, US	1
Bronx, US	1
Olocation not on record	1
Chapel Hill, US	1
Brown Universitylocation not on record	1
Catholic University of Pekinglocation not on record	1
Karlsruhe, DE	1
Clemson, US	1
Champaign, US	1
Copenhagen, DK	1
Madison, US	1

15 institutions · 25 of 61 vouchered records shown · 36 without an institution code

09Environmental DNA1 detections

Where the DNA of Myxotrichum chartarum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Verifiable raw sequence linked1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)