Myristica fragrans

Houtt. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Magnoliales/Myristicaceae/Myristica

At a glance

Occurrence records351

Data sources15

Biological traits24

DNA specimens9

eDNA detections7

Sources15 archives

Databases and archives Myristica fragrans's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility351 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

FooDBThe Metabolomics Innovation Centrecompounds↗

foodatlascompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Chemical compositionFooDB · FoodAtlas · LOTUS · NPASS5 967 compounds

Occurrence & distributionGBIF351 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB · GoaT1.2 Gbp

01Narrative

Le Muscadier est un arbre de la famille des Myristicacées produisant la noix de muscade. C'est un arbre tropical originaire des îles Banda dans l'archipel des Moluques en Indonésie et qui est cultivé maintenant majoritairement aux Antilles et au Guatemala. Deux espèces voisines fournissent des noix moins réputées.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height15 m

Seed mass667 mg

⚠ sources differ — TRY: 667 mg · GIFT: 7 793 mg

Seed mass max14 286 mg

Seed mass min667 mg

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeanimal

Flower length max5 mm

Flower length min4 mm

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition5 967 compounds

Compounds documented for Myristica fragrans across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cookingHerbs and Spices

Compound class profile5 classes

Cinnamic acids and derivatives101

Aminoacids80

Neolignans61

Furanoid lignans60

Glycerophospholipids57

Documented compounds5 967 total

Tissue Source Quantified only

Compound	Amount	Source
α-D-galactose	31,700 mg/100g	FooDB
Sugars	28,490 mg/100g	FooDB
17alpha-ethynylestradiol	9,500 mg/100g	FooDB
Elaidic acid	9,450 mg/100g	FooDB
Starch, pregelatinized	4,000 mg/100 g	FooDB
Dodecanoic acid	3,100 mg/100g	FooDB
4(10)-Thujene	2,439 mg/100g	FooDB

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Myristica fragrans has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes3

GenBank sequences10

eDNA detections7

Countries4

The DNA barcodea real sequence read deposited for this species

rbcLOQ446844.1 ↗524 bpPakistan

ACGT

AGAGTACAAATTGACTTATTATACTCCTGAATATGCAACCAAAGATACTGATATCTTAGCAGCATTCCGAGTAACTCCTCAACCCGGAGT …

Myristica fragrans voucher QRI 018 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK★rbcL10

animal barcodeplant barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Myristica fragrans carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 173 600 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Myristica fragrans1.17 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidydiploid inferred

Chromosome records42–482n range42median42mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 423×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-indian_vol1 — Simmonds, N.W. 1954

CCDB · book-fedorov — Simmonds 1954

CCDB · book-atlas-flowering-plants — Simmonds 1954

2n 482×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Morawetz W, Samuel R. (pers. comm. 1998).

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type351 records

Wild obs. + sensor167

Museum / vouchered179

Cultivated / captive3

Other2

Origin

Native1

Introduced4

Range

Area of Occupancy AOO936 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 54≤1 km 29≤10 km 16>10 km 18

117 georeferenced · 50 without coordinates

Open the mapobservation + sensor167

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 3≤1 km 10≤10 km 7>10 km 6

26 georeferenced · 153 without coordinates

Open the institutions mapphysical evidence179

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 45 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	18
Museo Entomologico de Leonlocation not on record	12
National Biodiversity Institute, Costa Ricalocation not on record	7
Museo Nacional de Costa Rica (MNCR)location not on record	5
Bronx, US	3
Auckland, NZ	3
TAFORI-LSRClocation not on record	3
Kew, GB	3
CNF-UFHBlocation not on record	3
HNBlocation not on record	2
Antiguo Cuscatlán, SV	2
St. Augustine, TT	2
Pondicherry, IN	2
Honolulu, US	2
Cibinong, ID	2
Paris, FR	2
Zürich, CH	2
Chicago, US	2
Berlin, DE	2
Phyletisches Museum Jenalocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1
UFBAlocation not on record	1
Moscow State Universitylocation not on record	1
Institut fur Allgemeine Mikrobiologielocation not on record	1
Mount Annan, AU	1
University of Hamburglocation not on record	1
GB	1
MEXUlocation not on record	1
Provincial Museum of Albertalocation not on record	1
Plocation not on record	1
University of Stellenboschlocation not on record	1
Miami, US	1
MeiseBGlocation not on record	1
Brisbane, AU	1
UFVJMlocation not on record	1
Coimbra, PT	1
UFABClocation not on record	1
National Herbarium of São Tomé and Principelocation not on record	1
Llocation not on record	1
ASUlocation not on record	1
Conservatoire Botanique National de Mascarinlocation not on record	1
Salvador, BR	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
BISHlocation not on record	1
Ilhéus, BR	1

45 institutions · 103 of 179 vouchered records shown · 76 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Myristica fragrans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter7.40 °C

Max temp (day)27.7 °C

Min temp (night)16.9 °C

Precipitation1.30 mm/mo

Air humidity48.6 %

Moisture balance-119 mm/mo

Vapour deficit1,342 Pa

Wind speed3.00 m/s

Cloud cover11.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Myristica fragrans

At a glance

Sources15 archives

Size & morphology4

Life cycle & reproduction9

Diet & foraging1

Habitat & environment8

Physiology & chemistry2

Compound class profile5 classes

Documented compounds5 967 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type351 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions20 of 45 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Documented compounds5 967 total