Myriophyllum verticillatum
speciesAt a glance
Occurrence records30 493
Data sources14
Biological traits40
DNA specimens27
eDNA detections14
Sources14 archives
Databases and archives Myriophyllum verticillatum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility30 490 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics27 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗On this page8 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources40 traits
Chemical compositionLOTUS · NPASS41 compounds
Occurrence & distributionGBIF · PBDB30 493 records
Environmental DNA1 datasets · 3 countries14 detections
DNA & barcodingBOLD · NCBI27 specimens
Genome at a glanceCCDB · GoaT2n = 28
Deep timePBDB3 fossils
01Narrative
Myriophyllum verticillatum, le myriophylle verticillé, est une espèce de plantes à fleurs dicotylédone de la famille des Haloragaceae. C'est une plante herbacée aquatique dont l'aire de répartition s'étend sur presque toute l'Europe, l'Asie occidentale et boréale ; le Japon ; l'Afrique septentrionale ; l'Amérique septentrionale et méridionale. Cette espèce, indigène en France métropolitaine, peut facilement être confondue avec d'autres espèces de myriophylles invasives comme le myriophylle du Brésil.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology13
Fruit length3 mm
Fruit length max3 mm
Fruit length min3 mm
Leaf length45 mm
Leaf length max50 mm
Leaf length min40 mm
Plant height0.713 m
⚠ sources differ — GIFT: 0.713 m · LEDA: 1.12 m · TRY: 1.25 m
Plant height generative0.2 m
Plant height max5 m
Plant height min0.2 m
Seed mass1.51 mg
Seed mass max1.51 mg
Seed mass min1.51 mg
Life cycle & reproduction11
Deciduousnessevergreen
Dispersal typewater
Flowering endAug
Flowering startJun
Life formhelophyte
Life spanperennial
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formcryptophyte
Reproduction asexualabsent
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment8
Aquaticaquatic
Climatetemperate
Climberself-supporting
Elevation mean2 800 m
Epiphyteterrestrial
Growth formherb
⚠ sources differ — GIFT: herb · TRY: hydrophyte
Habitat GIFTlakes, rivers, sand, shores
Woodinessnon-woody
Physiology & chemistry5
Leaf C:N ratio15.17 g/g
Leaf c412 mg/g
Leaf dry-matter content (LDMC)85.93 mg/g
Leaf n27.17 mg/g
Photosynthetic pathwayC3
Other traits1
Diaspore typemericarp
03Chemical composition41 compounds
Compounds documented for Myriophyllum verticillatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Ergostane steroids6
Bactoprenols6
Germacrane sesquiterpenoids4
Eudesmane sesquiterpenoids3
Acyclic triterpenoids3
Documented compounds41 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1S,3S,5R,8E,10S,11R)-10-hydroxy-3,8-dimethyl-12-methylidene-4,14-dioxatricyclo[9.3.0.03,5]tetradec-8-en-13-one | present | NPASS | |
| (2Z,6Z,10Z,14Z,18Z,22Z,26Z,30Z,34E,38E,42E)-3,7,11,15,19,23,27,31,35,39,43,47-dodecamethyloctatetraconta-2,6,10,14,18,22,26,30,34,38,42,46-dodecaen-1-ol | present | LOTUS | |
| (3aR,4S,5S,9E,11aR)-4,5-dihydroxy-10-methyl-3,6-dimethylidene-4,5,7,8,11,11a-hexahydro-3aH-cyclodeca[b]furan-2-one | present | NPASS | |
| (3aS,4R,4aS,8R,8aR,9aS)-4,8-dihydroxy-5,8a-dimethyl-3-methylidene-4,4a,7,8,9,9a-hexahydro-3aH-benzo[f][1]benzofuran-2-one | present | NPASS | |
| (3aS,4S,5E,9S,10E,11aS)-9-[[(3R,3aS,4R,5E,9E,11aS)-4-hydroxy-6,10-dimethyl-2-oxo-3a,4,7,8,11,11a-hexahydro-3H-cyclodeca[b]furan-3-yl]methyl]-4-hydroxy-6,10-dimethyl-3-methylidene-3a,4,7,8,9,11a-hexahydrocyclodeca[b]furan-2-one | present | NPASS | |
| (3S,3aS,4R,5E,9E,11aS)-4-hydroxy-3-(hydroxymethyl)-6,10-dimethyl-3a,4,7,8,11,11a-hexahydro-3H-cyclodeca[b]furan-2-one | present | NPASS | |
| (3S,4S,5S,9R,10S,13R,14R,17R)-17-[(2R,5S)-5,6-dimethylhept-6-en-2-yl]-4,10,13-trimethyl-2,3,4,5,6,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol | present | LOTUS | |
| (3S,4S,5S,9R,10S,13R,14R,17R)-17-[(2R,5S)-5,6-dimethylheptan-2-yl]-4,10,13-trimethyl-2,3,4,5,6,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol | present | LOTUS | |
| (3S,4S,5S,9R,10S,13R,17R)-17-[(2R,5S)-5,6-dimethylhept-6-en-2-yl]-4,10,13-trimethyl-2,3,4,5,6,7,9,11,12,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol | present | LOTUS | |
| (3S,4S,5S,9R,10S,13R,17R)-4,10,13-trimethyl-17-[(2R)-6-methyl-5-methylideneheptan-2-yl]-2,3,4,5,6,7,9,11,12,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol | present | LOTUS |
05DNA & barcoding27 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Myriophyllum verticillatum has left across the world's sequence archives.
At a glance
DNA specimens27
Marker genes6
GenBank sequences10
eDNA detections14
Countries5
The DNA barcodea real sequence read deposited for this species
ATGGCGACAATAACGAACCCCGGCGCGGAATGCGCCAAGGAAATCACAACGAACTCAGCACGCCGCTCGCCGACTCGTGCGGCAGCGGCG …
Myriophyllum verticillatum voucher KS23 HER0574 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL6★rbcLa★ITS2★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Myriophyllum verticillatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidypolyploid inferred
Chromosome records28–422n range28median28mode25records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2823×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · brit-fl +10
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · brit-fl — Hollingsworth, P.M. Watsonia : ()
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3024
CCDB · fl-europaea — Scheerer , 1940
CCDB · poland — Skali?ska M., Pogan E. et al. 1966. Further studies in chromosome numbers of Polish Angiosperms. Sixth contribution. Acta Biol. Cracov. Ser. Bot. 9, 31-58.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1995. Chromosome numbers in some species of vascular plants from the Russian Far East. Bot. Žhurn. (Moscow & Leningrad) 80(3): 85–88.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — AIKEN, S. 1978. In IUPB chromosome number reports LXII. Taxon 27: 519–535.
CCDB · ipcn-api-dl — Uhrikova, A. 1976. In Index of chromosome numbers of Slovakian flora. Part 5. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1–18.
CCDB · ipcn-api-dl — Probatova, N. S., E. G. Rudyka & S. A. Sokolovskaya. 1998. Chromosome numbers in vascular plants from the islands of Peter the Great Bay and Muravyov-Amurskiy Peninsula (Primorsky territory). Bot. Žhurn. (Moscow & Leningrad) 83(5): 125–130.
CCDB · book-ipcn66 — Skalinska et al. 1966
CCDB · book-indian_vol1 — Scheerer, H. 1940; Pogan (Skalinska, M. et al. 1966); Aiken, S. 1978
CCDB · book-fedorov — Scheerer 1940
CCDB · book-fedorov — Pogan (Skaliiiska et al. 1966)
CCDB · book-atlas-flowering-plants
CCDB · CromoCat 2015 — Aiken, S. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXII]. Taxon 27(5/6): 522.
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Probatova, N. S. & A. P. Sokolovskaya. (1995). Chromosome numbers in some species of vascular plants from the Russian Far East. Bot. Žurn. 80(3): 85-88.
CCDB · CromoCat 2015 — Probatova, N. S., E. G. Rudyka & S. A. Sokolovskaya (1998). Chromosome numbers in vascular plants from the islands of Peter the Great Bay and Muravyov-Amurskiy Peninsula (Primorsky territory). Bot. Žhurn. (Moscow & Leningrad) 83(5): 125–130
CCDB · CromoCat 2015 — Uhrikova, A. (1976). In Index of chromosome numbers of Slovakian flora. Part 5. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1-18.
CCDB · iapt — IAPT/IOPB Chromosome Data 26
2n 422×CCDB · book-indian_vol1 · CCDB · book-fedorov
CCDB · book-indian_vol1 — Harada, I. 1952
CCDB · book-fedorov — Harada 1952 (Love A. 1961b)
n 141×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Niehaus, T.F. (1968). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XV]. Taxon 17(1): 91-104.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time11.6–2.58 Ma
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
Fossil range11.6–2.58 Ma Miocene, Pliocene
Dated fossil finds3
StatusNot recorded since 2.58 Ma
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The solid bar is the fossil range: the span between the oldest and the youngest fossil that palaeontologists have assigned to Myriophyllum verticillatum. Above itBeside it, each dot is one dated fossil find — few enough to count, so they are drawn individually rather than as a graph.
fossil range (PBDB)each dot = one dated find
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type30 493 records
Wild obs. + sensor23 889
Museum / vouchered6 422
Cultivated / captive1
Fossil5
Other176
Origin
Native1 686
Introduced12
Range
Area of Occupancy AOO55 272 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy35% within 1 km
≤100 m 4 520≤1 km 2 483≤10 km 12 422>10 km 660
20 085 georeferenced · 3 804 without coordinates
Open the mapobservation + sensor23 889
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy38% within 1 km
≤100 m 590≤1 km 962≤10 km 1 424>10 km 1 100
4 076 georeferenced · 2 346 without coordinates
Open the institutions mapphysical evidence6 422
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions142 of 254 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Helsinki, FI | 936 |
| Uniwersytet Wrocławskilocation not on record | 579 |
| Oulu, FI | 325 |
| LDlocation not on record | 290 |
| Moscow State Universitylocation not on record | 239 |
| Tartu, EE | 164 |
| Uppsala, SE | 158 |
| MeiseBGlocation not on record | 156 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 149 |
| BFLlocation not on record | 145 |
| Turku, FI | 126 |
| SLU Artdatabankenlocation not on record | 119 |
| Metsähallituslocation not on record | 109 |
| Victoria, CA | 108 |
| Olocation not on record | 90 |
| Madison, US | 86 |
| St. Paul, US | 81 |
| PRClocation not on record | 80 |
| Oskarshamn, SE | 79 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 57 |
| BRNUlocation not on record | 57 |
| BIO-UNIPIlocation not on record | 56 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 45 |
| Museo Entomologico de Leonlocation not on record | 45 |
| DBF-NHMDlocation not on record | 43 |
| Nagano City, JP | 43 |
| CJBGlocation not on record | 41 |
| Görlitz, DE | 41 |
| Salzburg, AT | 39 |
| Zürich, CH | 39 |
| JP | 38 |
| Beijing, CN | 37 |
| Bern, CH | 37 |
| Ann Arbor, US | 36 |
| Chicago, US | 34 |
| Jyväskylä, FI | 33 |
| Adam Mickiewicz University in Poznańlocation not on record | 31 |
| Provincia di Livornolocation not on record | 30 |
| Institute of the biological problems of the North FEB RASlocation not on record | 30 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 30 |
| TUR-Alocation not on record | 29 |
| Kuopio, FI | 28 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 28 |
| GJOlocation not on record | 28 |
| MAlocation not on record | 26 |
| WTUlocation not on record | 26 |
| Tallinn, EE | 26 |
| Green Bay, US | 25 |
| South Kensington, GB | 24 |
| Université Lavallocation not on record | 22 |
| Tsukuba, JP | 21 |
| Saint John, CA | 19 |
| Zürich, CH | 17 |
| Fukushima Universitylocation not on record | 17 |
| Durham, US | 17 |
| Vancouver, CA | 16 |
| Trondheim, NO | 16 |
| Uniwersytet Warszawskilocation not on record | 15 |
| Philadelphia, US | 15 |
| València, ES | 15 |
| Corvallis, US | 14 |
| Nanjing, CN | 14 |
| Barcelona, ES | 13 |
| Québec, CA | 13 |
| New Haven, US | 13 |
| Sanda, JP | 13 |
| Uniwersytet Jagiellońskilocation not on record | 11 |
| Voronezh State Universitylocation not on record | 11 |
| Hokkaido University Museumlocation not on record | 11 |
| Hobart, AU | 11 |
| University of Alberta Museumslocation not on record | 11 |
| WINlocation not on record | 11 |
| Wlocation not on record | 11 |
| Pullman, US | 11 |
| Frauenfeld, CH | 10 |
| Missoula, US | 10 |
| BDBClocation not on record | 9 |
| LfUlocation not on record | 9 |
| Mlocation not on record | 9 |
| Wuzhou, CN | 9 |
| GMBAlocation not on record | 9 |
| Burlington, US | 9 |
| Urumqi, CN | 8 |
| University of Wisconsinlocation not on record | 8 |
| Kushiro City Museumlocation not on record | 8 |
| Toronto, CA | 8 |
| DULlocation not on record | 8 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 8 |
| KIRMlocation not on record | 7 |
| 盐城国家级珍禽自然保护区location not on record | 7 |
| Porrentruy, CH | 7 |
| Guangzhou, CN | 7 |
| Bourges, FR | 7 |
| Whitehorse, CA | 6 |
| Kunming, CN | 6 |
| Odawara, JP | 6 |
| IWEP FEB RASlocation not on record | 6 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 6 |
| Vitoria, ES | 6 |
| BClocation not on record | 6 |
| McWane Science Centerlocation not on record | 6 |
| Salamanca, ES | 5 |
| Toyama, JP | 5 |
| Bergen, NO | 5 |
| TROMlocation not on record | 5 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 5 |
| Baroda, IN | 5 |
| Guilin, CN | 5 |
| PrivatHerblocation not on record | 5 |
| Yukon Universitylocation not on record | 5 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 5 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 5 |
| Frankfurt am Main | 5 |
| Servico de Microbiologia e Imunologialocation not on record | 5 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 5 |
| Philadelphia, US | 4 |
| Chapel Hill, US | 4 |
| Entomological Society of Latvialocation not on record | 4 |
| Sendai, JP | 4 |
| Anchorage, US | 4 |
| GZUlocation not on record | 4 |
| IDElocation not on record | 4 |
| Pamplona, ES | 4 |
| Sapporo, JP | 4 |
| Auckland, NZ | 4 |
| Berlin, DE | 3 |
| Davis, US | 3 |
| ZRC-SAZUlocation not on record | 3 |
| Awka, NG | 3 |
| 河南豫北黄河故道湿地鸟类国家级自然保护区location not on record | 3 |
| San Sebastián, ES | 3 |
| Peking Universitylocation not on record | 3 |
| Lincoln, US | 3 |
| Claremont, US | 3 |
| Banyoles, ES | 3 |
| Logan, US | 3 |
| No collectionlocation not on record | 3 |
| Whitewater, US | 3 |
| Zhengzhou, CN | 3 |
| Changsha, CN | 3 |
| Guiyang, CN | 3 |
| NSMKlocation not on record | 3 |
| Royal Botanic Garden Edinburghlocation not on record | 3 |
| Museo Achille Folettolocation not on record | 3 |
| University of Stellenboschlocation not on record | 3 |
| ASUlocation not on record | 3 |
| KMNlocation not on record | 3 |
| Salvador, BR | 3 |
| Tilburg, NL | 3 |
| Museum of the Rockieslocation not on record | 3 |
| Tomioka, JP | 3 |
| National Museum Waleslocation not on record | 2 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 2 |
| Xiamen, CN | 2 |
| Henderson, US | 2 |
| Tuscaloosa, US | 2 |
| Paris, FR | 2 |
| Flagstaff, US | 2 |
| Chicago, US | 2 |
| Chiba, JP | 2 |
| H-Diewaldlocation not on record | 2 |
| Sion, CH | 2 |
| Alicante, ES | 2 |
| Yangling, CN | 2 |
| Ypsilanti, US | 2 |
| Dekalb, US | 2 |
| Riverside, US | 2 |
| Hamilton, US | 2 |
| Boise, US | 2 |
| Kew, GB | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| Shanghai, CN | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Sevilla, ES | 2 |
| Göteborg, SE | 2 |
| Moscow, US | 2 |
| Namur, BE | 2 |
| Porvoo, FI | 2 |
| Bloomington, US | 2 |
| München, DE | 2 |
| Davenport, US | 2 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 2 |
| Angwin, US | 2 |
| Museo universitario di Chietilocation not on record | 2 |
| H-Hohlalocation not on record | 2 |
| CJBNlocation not on record | 1 |
| ENTClocation not on record | 1 |
| Stockholm, SE | 1 |
| Arcata, US | 1 |
| Nijmegen, NL | 1 |
| Cheney, US | 1 |
| Urumqi, CN | 1 |
| Podgorica, ME | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Mississippi State, US | 1 |
| Kagoshima, JP | 1 |
| Chadron, US | 1 |
| Boumlocation not on record | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| BSBIlocation not on record | 1 |
| Mexico City, MX | 1 |
| Lanzhou, CN | 1 |
| SCAUlocation not on record | 1 |
| Denver, US | 1 |
| Wellington, NZ | 1 |
| CASlocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Sede dell'Orto botanico del Museo di Storia naturale dell'Università degli Studi di Parmalocation not on record | 1 |
| H-Starnlocation not on record | 1 |
| College Park, US | 1 |
| Caldwell, US | 1 |
| Brussel, BE | 1 |
| ISAlocation not on record | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Jackson, US | 1 |
| Xining, CN | 1 |
| BAYLUlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| INFlocation not on record | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| UIBlocation not on record | 1 |
| Bangkok, TH | 1 |
| Capital Normal Universitylocation not on record | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Gifu prefectural Museumlocation not on record | 1 |
| Durango, US | 1 |
| Pamplona, ES | 1 |
| Santa Barbara, US | 1 |
| Umeå Universitylocation not on record | 1 |
| JBSlocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| GB | 1 |
| Montréal, CA | 1 |
| Nishihara, JP | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Bozeman, US | 1 |
| Tempe, US | 1 |
| Glarus, CH | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Portland, US | 1 |
| Chaguaramas, TT | 1 |
| San Diego, US | 1 |
| Badajoz, ES | 1 |
| Musée des Confluenceslocation not on record | 1 |
| University of Birminghamlocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Cochabamba, BO | 1 |
| 1 | |
| Montréal, CA | 1 |
254 institutions · 5 991 of 6 422 vouchered records shown · 406 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA14 detections
Where the DNA of Myriophyllum verticillatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found14
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 14 detections have coordinates
Open the map3 countries0
Stranded masses in small shallow backwater p…Wetland | Ditch
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.7 °C 13.2–17.4
Seasonal swing summer↔winter15.0 °C
Max temp (day)19.7 °C 16.1–21.9
Min temp (night)11.2 °C 9.30–13.0
Precipitation71.7 mm/mo 53.0–86.2
Air humidity60.4 % 57.6–63.5
Moisture balance-48.9 mm/mo -54.3–0.6
Vapour deficit708 Pa 564–820
Wind speed4.30 m/s 2.60–4.60
Cloud cover41.7 % 36.5–47.3
CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.