Myriophyllum spicatum
speciesAt a glance
Occurrence records177 188
Data sources15
Biological traits65
DNA specimens45
eDNA detections43
Sources15 archives
Databases and archives Myriophyllum spicatum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility170 725 records↗
OBISOcean Biodiversity Information System6 459 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics45 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page8 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources65 traits
Chemical compositionLOTUS1 compounds
Occurrence & distributionGBIF · OBIS · PBDB177 188 records
Environmental DNA3 datasets · 12 countries43 detections
DNA & barcodingBOLD · NCBI45 specimens
Genome at a glanceCCDB · GoaT · NCBI998 Mbp
Deep timePBDB4 fossils
01Narrative
Le Myriophylle en épis est une espèce de plantes à fleurs du genre Myriophyllum et de la famille des Haloragaceae. C'est une plante aquatique vivace originaire d'Europe, d'Asie et d'Afrique du Nord. On le trouve maintenant également en Amérique du Nord, dans plus de 40 États américains et dans 4 provinces canadiennes.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology23
Fruit length2.5 mm
Fruit length max3 mm
Fruit length min2 mm
Fruit width max3 mm
Fruit width min2.5 mm
Inflorescence length max10 cm
Inflorescence length min6 cm
Leaf length35 mm
Leaf length max17 mm
Leaf length min3 mm
Leaf mass3.5 mg
Leaf size33.83 mm²
Plant height9.25 m
⚠ sources differ — GIFT: 9.25 m · LEDA: 1 m · TRY: 0.5 m
Plant height generative1.15 m
Plant height max25 m
Plant height min0.3 m
Seed length2.75 mm
Seed mass1.12 mg
⚠ sources differ — TRY: 1.12 mg · LEDA: 1.27 mg · GIFT: 1.16 mg
Seed mass max1.05 mg
Seed mass min1.04 mg
Seed volume3.3 mm³
Seed volume max3.3 mm³
Seed volume min3.3 mm³
Life cycle & reproduction16
Deciduousnessevergreen
Dispersal typewater
Flower colourred
Flower length max2.6 mm
Flower length min1.8 mm
Flowering endSep
Flowering startJun
Life formhydrosubshrub
Life spanperennial
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formcryptophyte
Reproduction asexualabsent
Seed number4
Self fertilizationabsent
Sex typemonoecious
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticaquatic
Climatetemperate
Climberself-supporting
Elevation max4 500 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Growth formherb
⚠ sources differ — GIFT: herb · TRY: hydrophyte
Habitat GIFTbrackish water, rivers, swamps
Leaf formfiliform
Mycorrhiza type0.011124015
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio12.03 g/g
Leaf c422 mg/g
Leaf dry-matter content (LDMC)133 mg/g
⚠ sources differ — TRY: 133 mg/g · LEDA: 204 mg/g
Leaf n35.19 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)67.11 mm²/mg
⚠ sources differ — TRY: 67.11 mm²/mg · LEDA: 26.7 mm²/mg · GIFT: 24.97 mm²/mg
Other traits5
Diaspore typegenerative dispersule
Inflorescencespike
Leaf arrangementwhorled
Shoot length max200 cm
Shoot length min4 cm
03Chemical composition1 compounds
Compounds documented for Myriophyllum spicatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Gallotannins1
Documented compounds1 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Eugeniin | present | LOTUS |
05DNA & barcoding45 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Myriophyllum spicatum has left across the world's sequence archives.
At a glance
DNA specimens45
Marker genes6
GenBank sequences10
eDNA detections43
Countries12
The DNA barcodea real sequence read deposited for this species
GATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGC …
Myriophyllum spicatum isolate 22-19 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL6★rbcLa★ITS1★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Myriophyllum spicatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size997 560 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Myriophyllum spicatum1.00 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 42 n = 21
Ploidypolyploid inferred
Chromosome records14–422n range39median42mode38records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4219×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · brit-fl +6
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · brit-fl — Hollingsworth, P.M. Watsonia : ()
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3026
CCDB · poland — Pogan E., Jankun A., Sawicka Z. et al. 1989. Further studies in chromosome numbers of Polish Angiosperms. Part XXII. Acta Biol. Cracov. Ser. Bot. 31, 1-17.
CCDB · ipcn-api-dl — Jankun, A. 1989. Further studies in chromosome numbers of Polish angiosperms. Part XXII. Acta Biol. Cracov., Ser. Bot. 31: 1–17.
CCDB · ipcn-api-dl — Pogan, E., A. Jankun & Z. Sawicka. 1990. Further studies in chromosome numbers of Polish angiosperms, part 22. Acta Biol. Cracov., Ser. Bot. 31: 1–17.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — AIKEN, S. 1978. In IUPB chromosome number reports LXII. Taxon 27: 519–535.
CCDB · ipcn-api-dl — Uhrikova, A. 1976. In Index of chromosome numbers of Slovakian flora. Part 5. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1–18.
CCDB · ipcn-api-dl — Nakata, M. & S. Nagai. 1998. Chromosome numbers of some aquatic plants collected in Toyama Prefecture. Bull. Bot. Gard. Toyama 37: 1–6.
CCDB · book-indian_vol1 — Lave, A.. 1961 ; Love, A. & Ritchie, J .C. 1966 ; Bhat, B.K. et al. 1975 ; Aiken, S. 1978
CCDB · book-fedorov — LOve A. 1961b
CCDB · book-fedorov — Love A., Ritchie 1966
CCDB · CromoCat 2015 — Aiken, S. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXII]. Taxon 27(5/6): 522.
CCDB · CromoCat 2015 — Hindakova, M. (1976). Index of chromosome numbers of Slovakian flora. (Part 5). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1-18.
CCDB · CromoCat 2015 — Löve, A. (1961b). Some notes on Myriophyllum spicatum s. lat. Rhodora 63: 139-145.
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1982b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXV]. Taxon 31(2): 344-360.
2n 2810×CCDB · ita-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +5
CCDB · ita-fl — AQUARO G., PERUZZI L., CESCA G. - 2004. Numeri cromosomici per la Flora Italiana 1446-1454. Inform. Bot. Ital. , 36(2): 419-424.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1995. Chromosome numbers in some species of vascular plants from the Russian Far East. Bot. Žhurn. (Moscow & Leningrad) 80(3): 85–88.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-indian_vol1 — Lave, A. 1954a; Love, A. & Love, D. 1956b ; Taylor, R.L. & Mulligan, G.A. 1968
CCDB · book-fedorov — LOve A. 1954a
CCDB · book-atlas-flowering-plants — Llive 1954
CCDB · Cave1956 — Love & Love b
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1956b). Cytotaxonomical conspectus of the Icelandic flora. Acta Horti Gothob. 20(4): 65-291.
CCDB · CromoCat 2015 — Löve, A. (1954a). Cytotaxonomical remarks on some American species of circumpolar taxa. Svensk Bot. Tidskr. 48: 211-232.
CCDB · CromoCat 2015 — Taylor, R. L. & G. A. Mulligan. (1968). Flora of the Queen Charlotte Island. Part 2. Cytologiacl aspects of the Vascular Plants. Queen's Printer Ottawa
2n 368×CCDB · slov-fl · CCDB · ipcn-api-dl · CCDB · book-northern-plants +4
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · ipcn-api-dl — Uhrikova, A. 1974a. In Index to chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.
CCDB · book-northern-plants — L. & L. (unpubl.).
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · book-indian_vol1 — Love, A. & Love, D. 1948 ; Hara, H. 1952
CCDB · book-fedorov — LOve A., LOve D. 1948
CCDB · book-fedorov — Hara H. 1952
CCDB · CromoCat 2015 — Hindakova, M. (1974). Index of chromosome numbers of Slovakian flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1-23.
2n 141×CCDB · kew
CCDB · kew — Baum A, Kenton AY, Bennett MD. (pers. comm. 1989).
n 216×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 150-154. Silvestre, S.Lagascalia9(2): 266-269(1980).
CCDB · ipcn-api-dl — Silvestre, S. 1980. In Numeros cromosomicos para la flora Espahola. 121-182. Lagascalia 9: 249–284.
CCDB · ipcn-api-dl — BHAT, B. K., S. K. BAKSHI & M. K. KAUL. 1975. In IOPB chromosome number reports XLIX. Taxon 24: 501–516.
CCDB · book-ipcn75-78 — Bhat et al. 1975
CCDB · CromoCat 2015 — Bhat, B. K., Bakshi, S. K. & Kaul, M. K. (1975). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLIX]. Taxon 24(4): 513-514.
CCDB · CromoCat 2015 — Silvestre, S. (1980). Números cromosómicos para la flora española, 150-154. Lagascalia 9(2): 266-269.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelScaffold
07Deep time3.6–0.01 Ma
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
Fossil range3.6–0.01 Ma Pliocene, Pleistocene
Dated fossil finds4
StatusStill living record runs to the present
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The solid bar is the fossil range: the span between the oldest and the youngest fossil that palaeontologists have assigned to Myriophyllum spicatum. Above itBeside it, each dot is one dated fossil find — few enough to count, so they are drawn individually rather than as a graph.
fossil range (PBDB)each dot = one dated find
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type177 188 records
Wild obs. + sensor122 335
Museum / vouchered15 627
Fossil22
Other39 204
Origin
Native9 419
Introduced9
Range
Area of Occupancy AOO170 964 km²
Depth
0–200 m sunlit5 078
200–1000 m twilight0
1–4 km midnight0
>4 km abyssal0
median 1.9 m · max 11.8 m · 5 078 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy42% within 1 km
≤100 m 32 362≤1 km 9 406≤10 km 57 159>10 km 777
99 704 georeferenced · 22 631 without coordinates
Open the mapobservation + sensor122 335
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 997≤1 km 1 444≤10 km 1 996>10 km 306
4 743 georeferenced · 10 884 without coordinates
Open the institutions mapphysical evidence15 627
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions194 of 342 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| 730location not on record | 1 501 |
| Uniwersytet Wrocławskilocation not on record | 1 162 |
| TÜ_EMIlocation not on record | 500 |
| Metsähallituslocation not on record | 394 |
| Moscow State Universitylocation not on record | 342 |
| Madison, US | 281 |
| LDlocation not on record | 257 |
| Uppsala, SE | 227 |
| PRClocation not on record | 208 |
| BFLlocation not on record | 191 |
| BRNUlocation not on record | 178 |
| MeiseBGlocation not on record | 175 |
| BIO-UNIPIlocation not on record | 168 |
| SLU Artdatabankenlocation not on record | 154 |
| Adam Mickiewicz University in Poznańlocation not on record | 129 |
| Tartu, EE | 128 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 123 |
| Beijing, CN | 108 |
| DBF-NHMDlocation not on record | 108 |
| Green Bay, US | 102 |
| Université Lavallocation not on record | 100 |
| Chongqing Museumlocation not on record | 95 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 90 |
| College Park, US | 81 |
| Osaka, JP | 79 |
| Oskarshamn, SE | 78 |
| Oregon State Universitylocation not on record | 78 |
| MAlocation not on record | 75 |
| Salzburg, AT | 73 |
| St. Paul, US | 73 |
| WTUlocation not on record | 66 |
| Nanjing, CN | 64 |
| Provincia di Livornolocation not on record | 60 |
| University of Wisconsinlocation not on record | 59 |
| Olocation not on record | 58 |
| Chicago, US | 57 |
| GJOlocation not on record | 57 |
| Philadelphia, US | 55 |
| Victoria, CA | 48 |
| CJBGlocation not on record | 46 |
| Tokushima, JP | 44 |
| South Kensington, GB | 40 |
| Bando, JP | 39 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 38 |
| Canadian Department of Agriculturelocation not on record | 37 |
| Ann Arbor, US | 36 |
| Pretoria, ZA | 36 |
| Görlitz, DE | 35 |
| València, ES | 35 |
| Kunming, CN | 35 |
| Tsukuba, JP | 35 |
| Bern, CH | 34 |
| Québec, CA | 34 |
| NSMKlocation not on record | 31 |
| Philadelphia, US | 31 |
| IDElocation not on record | 30 |
| Pullman, US | 29 |
| Nagano City, JP | 26 |
| Corvallis, US | 26 |
| Knoxville, US | 26 |
| ASUlocation not on record | 24 |
| Wlocation not on record | 23 |
| Odawara, JP | 23 |
| Flagstaff, US | 23 |
| Tallinn, EE | 23 |
| Allentown, US | 23 |
| BDBClocation not on record | 22 |
| LfUlocation not on record | 22 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 22 |
| Toyama, JP | 22 |
| Brussel, BE | 22 |
| Barcelona, ES | 22 |
| Museo Entomologico de Leonlocation not on record | 21 |
| Montréal, CA | 20 |
| Tomioka, JP | 20 |
| San Sebastián, ES | 20 |
| Vitoria, ES | 20 |
| Entomological Society of Latvialocation not on record | 19 |
| Otaru, JP | 19 |
| Jyväskylä, FI | 18 |
| Salamanca, ES | 18 |
| Frankfurt am Main | 17 |
| Vancouver, CA | 17 |
| CICYTEXlocation not on record | 17 |
| Badajoz, ES | 16 |
| Hokkaido University Museumlocation not on record | 16 |
| Trondheim, NO | 16 |
| Kochi, JP | 16 |
| TROMlocation not on record | 16 |
| Mlocation not on record | 15 |
| Madrid, ES | 15 |
| Guasave, MX | 15 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 15 |
| Toronto, CA | 15 |
| Taipei, TW | 14 |
| Chiba, JP | 14 |
| Kushiro City Museumlocation not on record | 14 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 13 |
| Davis, US | 13 |
| Chengdu, CN | 13 |
| Chapel Hill, US | 13 |
| Guilin, CN | 12 |
| Uniwersytet Jagiellońskilocation not on record | 12 |
| Moscow, US | 12 |
| Xining, CN | 12 |
| KIWElocation not on record | 12 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 12 |
| Cheney, US | 12 |
| Claremont, US | 12 |
| Wuzhou, CN | 11 |
| San Luis Obispo, US | 11 |
| PrivatHerblocation not on record | 11 |
| Portland, US | 11 |
| San Diego, US | 11 |
| University of Stellenboschlocation not on record | 10 |
| Riverside, US | 10 |
| Natural History Museum Rotterdamlocation not on record | 10 |
| Museo Achille Folettolocation not on record | 10 |
| BClocation not on record | 10 |
| Austin, US | 10 |
| Bergen, NO | 10 |
| GZUlocation not on record | 9 |
| Logan, US | 9 |
| Saint Louis, US | 9 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 9 |
| Nanjing, CN | 8 |
| Durban, ZA | 8 |
| ZRC-SAZUlocation not on record | 8 |
| Tuscaloosa, US | 8 |
| Boise, US | 8 |
| Kew, GB | 8 |
| Yangling, CN | 8 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 8 |
| BSBIlocation not on record | 8 |
| Nijmegen, NL | 7 |
| Pocatello, US | 7 |
| Bronx, US | 7 |
| Minia, EG | 7 |
| Berlin, DE | 7 |
| Lincoln, US | 7 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 7 |
| Peking Universitylocation not on record | 7 |
| Guangzhou, CN | 7 |
| National Herbarium & Botanic Gardens of Malawilocation not on record | 7 |
| Whitewater, US | 7 |
| Urumqi, CN | 7 |
| GMBAlocation not on record | 7 |
| Provo, US | 7 |
| Tilburg, NL | 6 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 6 |
| Xiamen, CN | 6 |
| Millersville, US | 6 |
| Granada, ES | 6 |
| Oswego, US | 6 |
| Fort Worth, US | 6 |
| Norfolk, US | 6 |
| Wuhan, CN | 6 |
| Porrentruy, CH | 6 |
| Jena Microbial Resource Collectionlocation not on record | 6 |
| Voronezh State Universitylocation not on record | 6 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| ISAlocation not on record | 5 |
| KMNlocation not on record | 5 |
| Phoenix, US | 5 |
| US | 5 |
| Hobart, AU | 5 |
| Museo universitario di Chietilocation not on record | 5 |
| Alicante, ES | 5 |
| Córdoba, ES | 5 |
| Philadelphia, US | 5 |
| Bloomington, US | 5 |
| Shinshu Universitylocation not on record | 5 |
| Albuquerque, US | 5 |
| Paris, FR | 5 |
| Chicago, US | 5 |
| TAIElocation not on record | 4 |
| Davenport, US | 4 |
| Sendai, JP | 4 |
| Inner Mongolia Universitylocation not on record | 4 |
| Awka, NG | 4 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 4 |
| Denton, US | 4 |
| Caldwell, US | 4 |
| Jackson, US | 4 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 4 |
| NMBU:MINAlocation not on record | 4 |
| Turku, FI | 4 |
| Dekalb, US | 4 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 4 |
| National Institute of Biological Resourceslocation not on record | 4 |
| Chengdu, CN | 4 |
| Tianjin Natural History Museumlocation not on record | 4 |
| McWane Science Centerlocation not on record | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| Bourges, FR | 4 |
| Oulu, FI | 4 |
| Nishihara, JP | 4 |
| KIRMlocation not on record | 4 |
| Tampa, US | 4 |
| Wellington, NZ | 4 |
| Taipei, TW | 4 |
| Hudson, US | 3 |
| DULlocation not on record | 3 |
| JBSlocation not on record | 3 |
| Kyoto Universitylocation not on record | 3 |
| Missoula, US | 3 |
| Sion, CH | 3 |
| CASlocation not on record | 3 |
| Williamsburg, US | 3 |
| Edinburgh, GB | 3 |
| Spearfish, US | 3 |
| Pamplona, ES | 3 |
| Strecker Museum, Baylor Universitylocation not on record | 3 |
| Henderson, US | 3 |
| Arcata, US | 3 |
| UGentlocation not on record | 3 |
| Frauenfeld, CH | 3 |
| Stockholm, SE | 3 |
| Burlington, US | 3 |
| University of Birminghamlocation not on record | 3 |
| The University of Arizonalocation not on record | 3 |
| Maryland Department of Natural Resourceslocation not on record | 3 |
| UIBlocation not on record | 3 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 3 |
| AUAlocation not on record | 3 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 3 |
| Fukushima Universitylocation not on record | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Sagamihara, JP | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| Bangkok, TH | 2 |
| Namur, BE | 2 |
| GB | 2 |
| Montréal, CA | 2 |
| Columbia, US | 2 |
| Shanghai, CN | 2 |
| Dresden, DE | 2 |
| Lausanne, CH | 2 |
| Saint John, CA | 2 |
| Salvador, BR | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Umeå Universitylocation not on record | 2 |
| NEAUlocation not on record | 2 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 2 |
| Auckland, NZ | 2 |
| Chadron, US | 2 |
| Hangzhou, CN | 2 |
| Royal Botanic Garden Edinburghlocation not on record | 2 |
| University of Lethbridgelocation not on record | 2 |
| Elocation not on record | 2 |
| NoColllocation not on record | 2 |
| Zhejiang Universitylocation not on record | 2 |
| Ensenada, MX | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Sapporo, JP | 2 |
| Zürich, CH | 2 |
| Whitehorse, CA | 2 |
| Sanda, JP | 2 |
| Madrid, ES | 2 |
| Angwin, US | 2 |
| Clocation not on record | 2 |
| Chicago, US | 2 |
| EL PASO, US | 2 |
| H-Schuhwlocation not on record | 2 |
| Ivano-Frankove, UA | 1 |
| Yaoundé, CM | 1 |
| University of Alberta Museumslocation not on record | 1 |
| OLAlocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| CJBNlocation not on record | 1 |
| US | 1 |
| Tempe, US | 1 |
| No collectionlocation not on record | 1 |
| Ojo, NG | 1 |
| KURAlocation not on record | 1 |
| University of Wisconsinlocation not on record | 1 |
| National Museum Waleslocation not on record | 1 |
| Mexico City, MX | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Tula State Universitylocation not on record | 1 |
| Juriquilla, MX | 1 |
| Brisbane, AU | 1 |
| USFSlocation not on record | 1 |
| University of Southern Mississippilocation not on record | 1 |
| La Paz, MX | 1 |
| Guangzhou, CN | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| New Haven, US | 1 |
| Pamplona, ES | 1 |
| Stockholm, SE | 1 |
| Podgorica, ME | 1 |
| München, DE | 1 |
| H-Hohlalocation not on record | 1 |
| Durango, MX | 1 |
| Xiangtan City, CN | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| Yunnan Universitylocation not on record | 1 |
| Obihiro Centennial City Museumlocation not on record | 1 |
| Hermosillo, MX | 1 |
| Miami, US | 1 |
| Mount Pleasant, US | 1 |
| Durham, US | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| Samara National Research Universitylocation not on record | 1 |
| Seoul, KR | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| FLADlocation not on record | 1 |
| Denver, US | 1 |
| Irvine, US | 1 |
| H-Starnlocation not on record | 1 |
| Gifu prefectural Museumlocation not on record | 1 |
| Zürich, CH | 1 |
| Fayetteville, US | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Sede dell'Orto botanico del Museo di Storia naturale dell'Università degli Studi di Parmalocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| US | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Kawasaki Shi Tama Ku, JP | 1 |
| Springfield, US | 1 |
| ENTClocation not on record | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Sevilla, ES | 1 |
| US | 1 |
| Brookings, US | 1 |
| Ashland, US | 1 |
| Nagatoro-machi, Chichibu-gun, JP | 1 |
| Boumlocation not on record | 1 |
| Trois-Rivières, CA | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| JP | 1 |
| Cambridge, US | 1 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 1 |
| Fulda, DE | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| J. Rusek Collectionlocation not on record | 1 |
342 institutions · 10 158 of 15 627 vouchered records shown · 5 387 without an institution code
09Environmental DNA43 detections
Where the DNA of Myriophyllum spicatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found43
Studies independent surveys3
Countries12
Verifiable raw sequence linked1
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 43 detections have coordinates
Open the map12 countries0
pondCoastal Sage Scrub/Freshwater Marsh with Mal…Clear flowing water
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median19.9 °C 10.5–25.1
Seasonal swing summer↔winter12.3 °C
Max temp (day)24.8 °C 14.3–28.0
Min temp (night)15.5 °C 6.90–21.2
Precipitation76.2 mm/mo 58.4–82.6
Air humidity64.5 % 57.5–65.7
Moisture balance-59.3 mm/mo -63.3–30.0
Vapour deficit1,019 Pa 488–1,092
Wind speed3.90 m/s 2.40–4.20
Cloud cover36.5 % 18.6–49.4
CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.