Myriophyllum indicum — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Haloragaceae/Myriophyllum

At a glance

Occurrence records8

Data sources6

Biological traits2

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Myriophyllum indicum's data was compiled from.

GBIFGlobal Biodiversity Information Facility8 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF8 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 14

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formhelophyte

Habitat & environment1

Climatewet tropical

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Myriophyllum indicum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLPX223764.1 ↗553 bpSri Lanka · 1977

ACGT

AAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGC …

Myriophyllum indicum voucher Cramer, L.H. 4900 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Myriophyllum indicum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Sarkar, A.K. et al. 1973a

n 71×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — SARKAR, A.K., N. DATTA., & U. CHATTERJEE. 1973. In IOPB chromosome number reports XLII. Taxon 22: 647-654.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type8 records

Museum / vouchered8

Range

Area of Occupancy AOO24 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence8

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	2
Kew, GB	2
University of Stellenboschlocation not on record	2
Bronx, US	1

4 institutions · 7 of 8 vouchered records shown · 1 without an institution code