Myriophyllum hippuroides — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Haloragaceae/Myriophyllum

At a glance

Occurrence records235

Data sources9

Biological traits9

DNA specimens4

eDNA detections3

Sources9 archives

Databases and archives Myriophyllum hippuroides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility235 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF235 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Уру́ть хвостникови́дная — вид цветковых растений рода Уруть (лат. Myriophyllum) семейства Сланоягодниковые (лат. Haloragaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formhelophyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Myriophyllum hippuroides has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences9

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG237773.1 ↗345 bpCanada · 1978

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCACTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGTATC …

Myriophyllum hippuroides voucher 55869HIM 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1rbcLaITS7ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type235 records

Wild obs. + sensor10

Museum / vouchered212

Other13

Range

Area of Occupancy AOO656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 7≤1 km 1

8 georeferenced · 2 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 32≤1 km 61≤10 km 28>10 km 8

129 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence212

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Corvallis, US	36
Mexico City, MX	22
WTUlocation not on record	19
Portland, US	15
Chicago, US	13
Canadian Department of Agriculturelocation not on record	12
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	10
Riverside, US	10
Arcata, US	7
Vancouver, CA	6
Philadelphia, US	5
Davis, US	4
Mexico City, MX	3
Santa Barbara, US	3
Juriquilla, MX	3
CASlocation not on record	3
Austin, US	3
San Diego, US	3
LDlocation not on record	2
Oskarshamn, SE	2
Logan, US	2
Claremont, US	2
Pullman, US	2
Moscow State Universitylocation not on record	1
Saint Louis, US	1
Durango, MX	1
Moscow, US	1
Zapopan, MX	1
PHlocation not on record	1
Chapel Hill, US	1
Cheney, US	1
ASUlocation not on record	1
South Kensington, GB	1
Portland, US	1
Madison, US	1
University of Guelph, OAC Herbariumlocation not on record	1

36 institutions · 200 of 212 vouchered records shown · 12 without an institution code

09Environmental DNA3 detections

Where the DNA of Myriophyllum hippuroides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 18.8–18.8

Seasonal swing summer↔winter16.0 °C

Max temp (day)25.0 °C

Min temp (night)14.0 °C

Precipitation58.4 mm/mo

Air humidity58.6 %

Moisture balance-58.3 mm/mo

Vapour deficit894 Pa

Wind speed2.00 m/s

Cloud cover32.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.