Myrianthus arboreus

P.Beauv. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Urticaceae/Myrianthus

At a glance

Occurrence records1 114

Data sources14

Biological traits22

DNA specimens11

eDNA detections5

Sources14 archives

Databases and archives Myrianthus arboreus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 114 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Chemical compositionLOTUS · NPASS24 compounds

Occurrence & distributionGBIF1 114 records

Environmental DNA1 datasets · 3 countries5 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Myrianthus arboreus, the giant yellow mulberry, or monkey fruit is a dioecious tropical tree in the genus Myrianthus. It lives in the tropical Central African countries of Central African Republic, Gabon, Cameroon, Nigeria, and Tanzania. It's chromosome count is 2n = 28.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height15 m

Plant height max20 m

Seed volume4 300 mm³

Seed volume max4 300 mm³

Seed volume min4 300 mm³

Life cycle & reproduction6

Deciduousnessevergreen

Dispersal typeanimal

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit typeother

Growth formtree

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition24 compounds

Compounds documented for Myrianthus arboreus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Ursane and Taraxastane triterpenoids13

Stigmastane steroids4

Oleanane triterpenoids4

Cholestane steroids $ Stigmastane steroids1

Imidazole alkaloids1

Documented compounds24 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ursolic Acid	present	LOTUS
(2R,3R,4S,5S,6S)-2-[[(3S,8S,9S,10R,13R,14S,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2R,4aS,6aR,6aS,6bR,8R,8aR,10S,12aR,14bR)-8,10-dihydroxy-2,4a,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-2-carboxylic acid	present	LOTUS
(3S,4R,4aR,6aR,6bS,8aS,11R,12R,12aR,14aR,14bR)-3,12-dihydroxy-4,6a,6b,11,12,14b-hexamethyl-1,2,3,4a,5,6,7,8,9,10,11,12a,14,14a-tetradecahydropicene-4,8a-dicarboxylic acid	present	LOTUS
Arjunolic Acid	present	LOTUS
beta-Sitosterol	present	LOTUS
Euscaphic acid	present	LOTUS
Euscaphic Acid Methyl Ester	present	LOTUS
KVCWSRZTJGVXQK-ZNTLCHEGSA-N	present	NPASS
methyl (1R,2R,4aS,6aR,6aS,6bR,8aR,10R,11R,12aR,14bS)-10-acetyloxy-1,11-dihydroxy-1,2,6a,6b,9,9,12a-heptamethyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylate	present	LOTUS

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Myrianthus arboreus has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes5

GenBank sequences4

eDNA detections5

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKY612111.1 ↗267 bpRepublic of the Congo

ACGT

GACCCGCGAACACGATACTCACGCTCGGGGGGCGAAAGGGCCTGTGGCCCTCGGACCCTCTGCCCGTCGGGGGCGCGCGCGGTTGAATTC …

Myrianthus arboreus voucher R. Richter 153 M internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Myrianthus arboreus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records28–282n range28median28mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 282×CCDB · book-fedorov · CCDB · Cave1957

CCDB · book-fedorov — Mangenot S., Ji.)an~c not G. 195i. 1962

CCDB · Cave1957 — Mangenot & Mangenot

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.960 ↗

08Occurrence & distribution

Record type1 114 records

Wild obs. + sensor608

Museum / vouchered500

Other6

Range

Area of Occupancy AOO1 428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 7≤1 km 14≤10 km 2>10 km 1

24 georeferenced · 584 without coordinates

Open the mapobservation + sensor608

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 2≤1 km 3≤10 km 3>10 km 4

12 georeferenced · 488 without coordinates

Open the institutions mapphysical evidence500

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Yaoundé, CM	58
Saint Louis, US	44
MeiseBGlocation not on record	44
LBVlocation not on record	36
BRLUlocation not on record	25
Kew, GB	23
WAGlocation not on record	18
Herbier National du Gabonlocation not on record	18
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	14
Adam Mickiewicz University in Poznańlocation not on record	11
CNF-UFHBlocation not on record	7
Leiden University Medical Centerlocation not on record	7
Plocation not on record	6
Pretoria, ZA	4
Ulocation not on record	4
Dresden, DE	3
HNBlocation not on record	3
Daubeny Herbarium, Oxfordlocation not on record	3
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	3
IPA/SPlocation not on record	3
Bronx, US	3
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	2
National Botanical Gardens of Belgiumlocation not on record	2
EFGlocation not on record	2
Edinburgh, GB	2
MAlocation not on record	2
Llocation not on record	1
TAFORI-LSRClocation not on record	1
Frankfurt am Main	1
Coimbra, PT	1
Glocation not on record	1
Université du Lomélocation not on record	1
CJBGlocation not on record	1
Mlocation not on record	1
Elocation not on record	1
Institute for Agricultural Research of Mozambiquelocation not on record	1
Uppsala, SE	1
UPNlocation not on record	1
University of Santo Tomas Museumlocation not on record	1
Claremont, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1

41 institutions · 362 of 500 vouchered records shown · 138 without an institution code

09Environmental DNA5 detections

Where the DNA of Myrianthus arboreus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 23.8–26.9

Seasonal swing summer↔winter2.50 °C

Max temp (day)29.4 °C 28.3–30.8

Min temp (night)20.7 °C 20.4–24.1

Precipitation82.0 mm/mo 45.8–157

Air humidity67.9 % 64.8–70.0

Moisture balance-55.8 mm/mo -89.0–26.6

Vapour deficit1,112 Pa 886–1,152

Wind speed1.60 m/s 1.00–2.60

Cloud cover25.6 % 16.4–57.0

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Myrianthus arboreus

At a glance

Sources14 archives

Size & morphology5

Life cycle & reproduction6

Diet & foraging1

Habitat & environment7

Physiology & chemistry2

Other traits1

Compound class profile5 classes

Documented compounds24 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 114 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 41 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 114 records