Myrciaria vexator — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Myrciaria

At a glance

Occurrence records3

Data sources6

Biological traits13

DNA specimens2

eDNA detections2

Sources6 archives

Databases and archives Myrciaria vexator's data was compiled from.

GBIFGlobal Biodiversity Information Facility3 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF3 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height10 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Myrciaria vexator has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN295347.1 ↗652 bpUSA

ACGT

GTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCCTAGCAGAATGACCAGAGAACTCGTAAAGAACTCATAGGGGACGGTGGGTGT …

Myrciaria vexator voucher FTG:Flickinger 2015-FTG-5 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type3 records

Museum / vouchered3

Range

Area of Occupancy AOO4 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Miami, US	3

1 institutions · 3 of 3 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Myrciaria vexator was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.