Myrciaria glazioviana

(Kiaersk.) G.M.Barroso ex Sobral · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Myrciaria

At a glance

Occurrence records745

Data sources11

Biological traits17

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Myrciaria glazioviana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility745 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources17 traits

Occurrence & distributionGBIF745 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT234 Mbp

01Narrative

Myrciaria glazioviana, the cabeluda, or yellow jaboticaba, is a species of plant in the family Myrtaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology2

Plant height3 m

Plant height max5 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max500 m

Elevation min0 m

Epiphyteterrestrial

Growth formshrub

Habitat GIFTFloresta Ombrófila (= Floresta Pluvial)

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Myrciaria glazioviana has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPP038296.1 ↗584 bpBrazil

ACGT

CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCCTAGCAGAATGCCAGAGAACTCGTAATGAACTCAATG …

Myrciaria glazioviana small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Myrciaria glazioviana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size233 742 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Myrciaria glazioviana0.23 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Ribeiro da Costa I, Dornelas MC, Forni-Martins ER. 2008. Nuclear genome size variation in fleshy-fruited Neotropical Myrtaceae. Plant Systematics and Evolution 276: 209-217.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type745 records

Wild obs. + sensor563

Museum / vouchered182

Origin

Native62

Range

Area of Occupancy AOO1 916 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 380≤1 km 20≤10 km 7

407 georeferenced · 156 without coordinates

Open the mapobservation + sensor563

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 182 records without

Open the institutions mapphysical evidence182

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 45 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
JBRJlocation not on record	25
UFRRJlocation not on record	25
Salvador, BR	13
San Jose State University, Museum of Birds and Mammalslocation not on record	13
UFPElocation not on record	8
Blumenau, BR	8
Kew, GB	7
UnBlocation not on record	7
Seropédica, BR	6
UFBAlocation not on record	6
Istituto Agrario Castelnuovolocation not on record	5
Bronx, US	5
Ivano-Frankivsk, UA	4
Cascavel, BR	3
INMAlocation not on record	3
Institut fur Allgemeine Mikrobiologielocation not on record	3
UEMlocation not on record	3
Departamento de Geologia, Universidad de Chilelocation not on record	2
Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record	2
Cenargenlocation not on record	2
Saint Louis, US	2
Departamento de Sistematica e Ecologialocation not on record	2
HUENFlocation not on record	2
Foz do Iguaçu, BR	2
Chicago, US	2
Brasília, BR	2
PUC-RIOlocation not on record	2
USP-IBlocation not on record	1
IPA/SPlocation not on record	1
Universidade Federal do Espírito Santolocation not on record	1
Universidade Federal de Santa Catarinalocation not on record	1
UNESClocation not on record	1
Paris, FR	1
UFESlocation not on record	1
Cruz das Almas, BR	1
UFPRlocation not on record	1
UERJlocation not on record	1
UFSJlocation not on record	1
UFABClocation not on record	1
Universidade Paulistalocation not on record	1
CEPLAClocation not on record	1
UTFPR-DVlocation not on record	1
UNESP-FCAlocation not on record	1
Instituto do Meio Ambientelocation not on record	1
UFSClocation not on record	1

45 institutions · 182 of 182 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Myrciaria glazioviana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)