Myliobatis freminvillei

Lesueur, 1824 · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Myliobatiformes/Myliobatidae/Myliobatis

At a glance

Occurrence records4 776

Data sources10

Biological traits8

DNA specimens31

eDNA detections99

Sources10 archives

Databases and archives Myliobatis freminvillei's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 000 records↗

OBISOcean Biodiversity Information System2 776 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI99 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF · OBIS4 776 records

Environmental DNA2 datasets · 1 countries99 detections

DNA & barcodingBOLD31 specimens

Genome at a glanceGoaT · NCBI5 Gbp

01Narrative

Myliobatis freminvillii est une espèce de raie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length129 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceminor commercial

Other traits3

Depth max100 m

Depth min0 m

Vulnerability82.5

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Myliobatis freminvillei has left across the world's sequence archives.

At a glance

DNA specimens31

BINs1

Marker genes1

eDNA detections99

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

34Amostly conserved

91Gvariable

193Gvariable

316Tvariable

352Cvariable

427Avariable

538Avariable

562Cvariable

CCTTTACTTGATCTTTGGTGCATGAGCAGGGATAGTGGGCACTGCCCTCAGTCTACTAATCCGAACAGAACTAAGTCAACCGGGGGCCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.55%

Haplotypes5

BIN1

Most divergent pair1.4%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Myliobatis longirostrissame genus6.1%Myliobatis aquilasame genus8.3%Myliobatis goodeisame genus9.2%Myliobatis ridenssame genus9.2%Myliobatis chilensissame genus9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Myliobatis freminvillei carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size4 987 800 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Myliobatis freminvillei4.99 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 52 n = 26

Chromosome records52–522n range52median52mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 522×GoaT · Animal Chromosome Counts Database · GoaT · Animal Genome Size Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Animal Genome Size Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type4 776 records

Wild obs. + sensor4 480

Museum / vouchered294

Other2

Origin

Native4

Range

Area of Occupancy AOO7 380 km²

Depth

0–200 m sunlit2 358

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 10.2 m · max 165 m · 2 358 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 234≤1 km 17≤10 km 5>10 km 12

268 georeferenced · 4 212 without coordinates

Open the mapobservation + sensor4 480

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 2≤1 km 4≤10 km 17>10 km 15

38 georeferenced · 256 without coordinates

Open the institutions mapphysical evidence294

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	36
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	17
North Carolina Museum of Natural Scienceslocation not on record	17
Cambridge, US	10
University of Texas Biodiversity Collections (UTBC)location not on record	6
FishBaselocation not on record	5
Zoologisches Museum Hamburglocation not on record	4
Los Angeles, US	3
Wuzhou, CN	2
Museu de Zoologia da Universidade de Sao Paulolocation not on record	1
University of Alabamalocation not on record	1
Instituto Nacional de Investigacion y Desarrollo Pesquerolocation not on record	1
Toronto, CA	1
CENPAT-CONICETlocation not on record	1

14 institutions · 105 of 294 vouchered records shown · 55 without an institution code

09Environmental DNA99 detections

Where the DNA of Myliobatis freminvillei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found99

Studies independent surveys2

Countries1

Verifiable raw sequence linked68

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 99 detections have coordinates

Open the map1 country0

Atlantic Ocean

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 2.60–23.6

Seasonal swing summer↔winter20.9 °C

Max temp (day)13.4 °C 5.30–25.5

Min temp (night)9.80 °C 0.4–22.5

Precipitation90.9 mm/mo 84.2–110

Air humidity57.7 % 56.9–63.7

Vapour deficit566 Pa 320–1,071

Cloud cover48.9 % 32.4–55.8

CHELSA 1981–2010, ~9 km grid, at location & month of 69 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Myliobatis freminvillei

At a glance

Sources10 archives

Size & morphology1

Habitat & environment3

Uses & economy1

Other traits3

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type4 776 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 776 records