Mycosphaerella recutita — The Life Data

Fungi/Ascomycota/Dothideomycetes/Mycosphaerellales/Mycosphaerellaceae/Mycosphaerella

At a glance

Occurrence records101

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Mycosphaerella recutita's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility101 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF101 records

DNA & barcodingNCBIsequences

01Narrative

Mycosphaerella recutita is a fungal plant pathogen. In Iceland, it is rather common on withered Elymus caninus, Festuca rubra and Hierochloe odorata.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mycosphaerella recutita has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF362059.1 ↗546 bp

ACGT

TCCGTAGGTGACCCTGCGGAAGGATCATTAAATAATCGGTAGTTTACTCGTGTGAAGGGGGTGAAACTTTCTAGGCCTTTTTGAACGTAG …

Mycosphaerella recutita 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS2

fungal barcode

08Occurrence & distribution

Record type101 records

Wild obs. + sensor34

Museum / vouchered67

Range

Area of Occupancy AOO336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy15% within 1 km

≤100 m 2≤1 km 3≤10 km 29

34 georeferenced

Open the mapobservation + sensor34

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤1 km 6≤10 km 12>10 km 15

33 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence67

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	11
Uppsala, SE	10
CA	7
LDlocation not on record	7
Zürich, CH	5
Olocation not on record	4
Bernard Price Institute for Palaeontological Researchlocation not on record	3
Karlsruhe, DE	3
Tartu, EE	2
TROMlocation not on record	2
Toronto, CA	2
Mlocation not on record	1
Pullman, US	1
Kew, GB	1
AASlocation not on record	1
Nurata nature reservelocation not on record	1
Trondheim, NO	1
MeiseBGlocation not on record	1

18 institutions · 63 of 67 vouchered records shown · 4 without an institution code