Mycosphaerella rabiei

Kovatsch. ex Gruyter · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Mycosphaerellales/Mycosphaerellaceae/Mycosphaerella

At a glance

Occurrence records0

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Mycosphaerella rabiei's data was compiled from.

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Chemical compositionLOTUS9 compounds

DNA & barcodingNCBIsequences

Genome at a glanceGoaT · NCBI≈41 Mbp

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition9 compounds

Compounds documented for Mycosphaerella rabiei across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Decalins with 2-pyrones4

Cytochalasan alkaloids3

2-pyrone derivatives $ Decalins with 2-pyrones2

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(16-Benzyl-5,12-dihydroxy-5,7,14-trimethyl-13-methylidene-6,18-dioxo-17-azatricyclo[9.7.0.01,15]octadeca-3,9-dien-2-yl) acetate	present	LOTUS
(3S,3aR,4S,6S,7E,10S,12R,13E,15R,15aR)-3-benzyl-6,12-dihydroxy-4,10,12-trimethyl-5-methylene-1,11-dioxo-2,3,3a,4,5,6,6a,9,10,11,12,15-dodecahydro-1H-cycloundeca[d]isoindol-15-yl acetate	present	LOTUS
3-(Hydroxymethyl)-4-methoxy-6-((1R,2S,4aR,8aR)-1,2,4a,5,6,7,8,8a-octahydro-2-methyl-1-naphthalenyl)-2H-pyran-2-one	present	LOTUS
6-[(1R,2S,4aR,8aR)-2-methyl-1,2,4a,5,6,7,8,8a-octahydronaphthalen-1-yl]-4-(2-hydroxyethylamino)oxy-2-oxopyran-3-carbaldehyde	present	LOTUS
Cytochalasin D	present	LOTUS
Solanapyrone A	present	LOTUS
Solanapyrone C	present	LOTUS
Solanopyrone A	present	LOTUS
Solanopyrone C	present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mycosphaerella rabiei has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPZ343131.1 ↗406 bpKazakhstan · 2024

ACGT

CTGCGGAAGGATCATTACCTAGAGTTTGTGGGCTTTGCCCGCTACCTCTTACCCATGTCTTTTGAGTACTTACGTTTCCTCGGCGGGTCC …

Ascochyta rabiei isolate CP-2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Mycosphaerella rabiei carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈40 846 718 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Mycosphaerella rabiei0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

Completeness98.5% BUSCO

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)