Mycosphaerella pomi — The Life Data

Fungi/Ascomycota/Dothideomycetes/Mycosphaerellales/Mycosphaerellaceae/Mycosphaerella

At a glance

Occurrence records29

Data sources7

Biological traits0

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Mycosphaerella pomi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility29 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF29 records

DNA & barcodingNCBIsequences

01Narrative

Mycosphaerella pomi is a fungus in the Mycosphaerellaceae family. It was first described by Giovanni Passerini in 1878 as Sphaerella pomi, and transferred to the genus, Mycosphaerella, in 1897 by Gustav Lindau. The species epithet, pomi, is the genitive of Latin, pomum ("apple") and refers to the fact that this is a fungus found on apples.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mycosphaerella pomi has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAB795263.1 ↗495 bp

ACGT

TTCGGGCTCGACCTCCACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGACGGCGAGCGCCCCCGGAGGCCTTC …

Mycosphaerella pomi genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, isolate: ka01

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type29 records

Wild obs. + sensor3

Museum / vouchered25

Cultivated / captive1

Range

Area of Occupancy AOO64 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 4≤10 km 7>10 km 1

12 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence25

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	12
Kew, GB	1
Museo Entomologico de Leonlocation not on record	1
ILLSlocation not on record	1
LDlocation not on record	1

5 institutions · 16 of 25 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.