Mycena plumipes

(Kalchbr.) P.-A.Moreau · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Mycenaceae/Mycena

At a glance

Occurrence records2 284

Data sources6

Biological traits0

DNA specimens8

eDNA detections25

Sources6 archives

Databases and archives Mycena plumipes's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 284 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF2 284 records

Environmental DNA2 datasets · 17 countries25 detections

DNA & barcodingBOLD · NCBI8 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mycena plumipes has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes2

GenBank sequences7

eDNA detections25

Countries17

The DNA barcodea real sequence read deposited for this species

ITSMH366792.1 ↗419 bpChina · 2017

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATACTGAATCGGTTCTGATGCTGGCTCTTCACTGGGCATG …

Mycena plumipes isolate HB678 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7★ITS1

fungal barcode

08Occurrence & distribution

Record type2 284 records

Wild obs. + sensor2 005

Museum / vouchered276

Other3

Range

Area of Occupancy AOO5 552 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 928≤1 km 217≤10 km 577>10 km 5

1 727 georeferenced · 278 without coordinates

Open the mapobservation + sensor2 005

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 50≤1 km 114≤10 km 50>10 km 5

219 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence276

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	78
Kuopio, FI	24
SLU Artdatabankenlocation not on record	22
WU-MYClocation not on record	16
Helsinki, FI	15
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	10
Trondheim, NO	9
University of Oslo, Natural History Museumlocation not on record	5
Salzburg, AT	5
Philadelphia, US	4
TUR-Alocation not on record	4
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
Zürich, CH	3
TROMlocation not on record	3
Turku, FI	2
Göteborg, SE	2
Karlsruhe, DE	2
BDBClocation not on record	1
Oulu, FI	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
Tromso University Museumlocation not on record	1
Uppsala, SE	1
nsnflocation not on record	1
CJBGlocation not on record	1

24 institutions · 215 of 276 vouchered records shown · 60 without an institution code

09Environmental DNA25 detections

Where the DNA of Mycena plumipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys2

Countries17

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map17 countries0

Southern/middle boreal, 40 years old, eutrop…masseforekomst i grenseomr. Picea-Alnus inc.…PalearcticNearcticAustralasiaPicea - cone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.10 °C -0.2–15.4

Seasonal swing summer↔winter20.0 °C

Max temp (day)10.4 °C 3.10–19.8

Min temp (night)2.60 °C -5.20–11.7

Precipitation76.2 mm/mo 53.3–180

Air humidity62.0 % 58.7–70.9

Moisture balance13.3 mm/mo -25.6–89.9

Vapour deficit405 Pa 220–680

Wind speed2.90 m/s 1.00–6.10

Cloud cover45.9 % 35.4–52.0

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Mycena plumipes

At a glance

Sources6 archives

At a glance

Record type2 284 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 284 records