Mycena citricolor

(Berk. & M.A.Curtis) Sacc. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Mycenaceae/Mycena

At a glance

Occurrence records64

Data sources7

Biological traits0

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Mycena citricolor's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility64 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF64 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaT · NCBI≈78 Mbp

01Narrative

Mycena citricolor is a species of mushroom-forming fungus in the family Mycenaceae. It is a plant pathogen producing leaf spots on coffee plants. This fungus causes the disease commonly known as American Leaf Spot. Mycena citricolor affects coffee plants, primarily in Latin America, but can grow on other plants as well. This fungus can grow on all parts of the coffee plant including the leaves, stems and fruits. When grown on the leaves, Mycena citricolor results in leaves with holes that often fall from the plant.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mycena citricolor has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences8

Countries3

The DNA barcodea real sequence read deposited for this species

ITSON831500.1 ↗454 bpCosta Rica

ACGT

AAAAAGTCATTAAACCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTG …

Mycena citricolor isolate LAMY internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Mycena citricolor carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈77 511 139 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Mycena citricolor0.08 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness96% BUSCO

08Occurrence & distribution

Record type64 records

Wild obs. + sensor17

Museum / vouchered24

Cultivated / captive23

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy11% within 1 km

≤1 km 1≤10 km 2>10 km 6

9 georeferenced · 8 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 9≤10 km 3

12 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence24

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 23 records without

Open the mapnot free-living23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	5
Durango, MX	5
TENN-Flocation not on record	4
Bernard Price Institute for Palaeontological Researchlocation not on record	2
Copenhagen, DK	1
Fungario QCAM de la Pontificia Universidad Católica del Ecuadorlocation not on record	1
FLASlocation not on record	1

7 institutions · 19 of 24 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)