Mustelus asterias

Cloquet, 1819 · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Carcharhiniformes/Triakidae/Mustelus

At a glance

Occurrence records15 350

Data sources10

Biological traits0

DNA specimens124

eDNA detections81

Sources10 archives

Databases and archives Mustelus asterias's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 330 records↗

OBISOcean Biodiversity Information System10 020 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI81 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics124 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS15 350 records

Environmental DNA4 datasets · 1 countries81 detections

DNA & barcodingBOLD124 specimens

Genome at a glanceGoaT · NCBI4.2 Gbp

01Narrative

L'Émissole tachetée est une espèce de requins de la famille des Triakidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding124 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mustelus asterias has left across the world's sequence archives.

At a glance

DNA specimens124

BINs1

Marker genes1

eDNA detections81

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus122 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

247Cvariable

250Amostly conserved

CCTTTACTTAATTTTTGGTGCATGAGCAGGCATAGTTGGAACAGCCCTAAGCCTTCTAATTCGAGCCGAACTGGGACAGCCAGGATCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes4

BIN1

Most divergent pair0.31%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mustelus schmittisame genus1.5%Mustelus mentosame genus2.0%Triakis megalopterussame family4.4%Scylliogaleus queckettisame family5.5%Mustelus punctulatussame genus7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Mustelus asterias carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size4 205 400 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Mustelus asterias4.21 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness93.5% BUSCO

08Occurrence & distribution

Record type15 350 records

Wild obs. + sensor5 252

Museum / vouchered466

Other9 632

Range

Area of Occupancy AOO13 624 km²

Depth

0–200 m sunlit9 598

200–1000 m twilight13

1–4 km midnight0

>4 km abyssal0

median 31 m · max 611 m · 9 611 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 716≤1 km 170≤10 km 584>10 km 21

1 491 georeferenced · 3 761 without coordinates

Open the mapobservation + sensor5 252

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 36≤1 km 1≤10 km 9>10 km 3

49 georeferenced · 417 without coordinates

Open the institutions mapphysical evidence466

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ilvolocation not on record	67
Research Institute for Agriculture, Fisheries and Food (ILVO)location not on record	58
DASSHlocation not on record	23
Copenhagen, DK	9
Paris, FR	8
FishBaselocation not on record	8
Stockholm, SE	5
ICM-CSIClocation not on record	5
South Kensington, GB	5
Zoologisches Museum Hamburglocation not on record	3
Washington, US	3
PNHSlocation not on record	2
VLIZ \| ILVOlocation not on record	1
Cambridge, US	1
RWSlocation not on record	1
Ugentlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
University of California San Diegolocation not on record	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1

19 institutions · 203 of 466 vouchered records shown · 35 without an institution code

09Environmental DNA81 detections

Where the DNA of Mustelus asterias was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found81

Studies independent surveys4

Countries1

Verifiable raw sequence linked79

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 81 detections have coordinates

Open the map1 country0

North Sea

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 9.90–16.1

Seasonal swing summer↔winter12.5 °C

Max temp (day)17.2 °C 11.0–17.5

Min temp (night)14.5 °C 8.70–14.9

Precipitation80.8 mm/mo 73.9–102

Air humidity62.8 % 62.6–64.0

Vapour deficit672 Pa 437–680

Cloud cover43.5 % 42.5–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 79 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Mustelus asterias

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type15 350 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type15 350 records