Musca autumnalis

De Geer, 1776 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Muscidae/Musca

At a glance

Occurrence records16 853

Data sources10

Biological traits0

DNA specimens482

eDNA detections828

Sources10 archives

Databases and archives Musca autumnalis's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility16 853 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI828 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics482 specimens↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionNPASS6 compounds

Occurrence & distributionGBIF16 853 records

Environmental DNA5 datasets · 16 countries828 detections

DNA & barcodingBOLD482 specimens

Genome at a glanceGoaT · TreeOfSex · NCBI≈1.4 Gbp

01Narrative

Musca autumnalis on Apiaceae flowers Musca autumnalis, the face fly or autumn housefly, is a pest of cattle and horses.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition6 compounds

Compounds documented for Musca autumnalis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Aporphine alkaloids $ Isoquinoline alkaloids2

Isoquinoline alkaloids $ Protopine alkaloids2

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids1

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Glaucine	present	NPASS
(R)-6-Methyl-5,6,6a,7-tetrahydro-4H-dibenzo[de,g]quinoline	present	NPASS
(R)-N-Methylcoclaurine	present	NPASS
alpha-Allocryptopine	present	NPASS
OYONMULSODZRLZ-UHFFFAOYSA-N	present	NPASS
Protopine	present	NPASS

05DNA & barcoding482 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Musca autumnalis has left across the world's sequence archives.

At a glance

DNA specimens482

BINs1

Marker genes2

eDNA detections828

Countries16

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus299 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

78Gmostly conserved

243Gmostly conserved

468Gmostly conserved

ACCTTATATTTTATCTTTGGAGCATGATCTGGTATAATTGGAACTTCATTAAGAATTTTAATTCGAGCTGAATTAGGGCACCCTGGTGCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.71%

Haplotypes17

BIN1

Most divergent pair10.5%

N.AmericaEuropeOtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Musca vitripennissame genus5.5%Musca convexifronssame genus5.7%Musca sorbenssame genus6.4%Musca larviparasame genus6.4%Musca conducenssame genus6.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex · NCBI

The complete instruction manual Musca autumnalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 446 201 459 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Musca autumnalis1.45 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Chromosome records12–122n range12median12mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 126×GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Boyes, J. and J. M. Van Brink (1965). "Chromosomes of Calyptrate Diptera." Canadian Journal of Genetics and Cytology 7(4): 537-550. ↗

TreeOfSex · invert — Boyes, J., M. J. Corey and H. Paterson (1964). "Somatic chromosomes of higher Diptera: IX. Karyotypes of some muscid species." Canadian Journal of Zoology 42(6): 1025-1036. ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type16 853 records

Wild obs. + sensor15 737

Museum / vouchered1 086

Cultivated / captive30

Origin

Native4

Range

Area of Occupancy AOO19 144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy34% within 1 km

≤100 m 3 528≤1 km 1 330≤10 km 9 321>10 km 60

14 239 georeferenced · 1 498 without coordinates

Open the mapobservation + sensor15 737

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 194≤1 km 174≤10 km 367>10 km 36

771 georeferenced · 315 without coordinates

Open the institutions mapphysical evidence1 086

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 30 records without

Open the mapnot free-living30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	125
NCMGlocation not on record	113
MZLUlocation not on record	98
US	65
Gothenburg, SE	62
University of Guelph, Centre for Biodiversity Genomicslocation not on record	57
Stockholm, SE	33
SLU Artdatabankenlocation not on record	30
Tilburg, NL	23
University of Tokyo, Department of Zoologylocation not on record	22
WIlocation not on record	20
University Park, US	13
Tromsø, NO	13
Provo, US	12
Toronto, CA	11
South Kensington, GB	10
DFFW2016location not on record	5
Museu Nacional de História Natural e da Ciêncialocation not on record	5
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	4
CBDClocation not on record	4
DFFW1981location not on record	4
Essig Museum of Entomologylocation not on record	4
Salzburg, AT	3
Universidad Católica de Manizaleslocation not on record	3
SGAV-and-NHMDlocation not on record	3
ZMAAlocation not on record	3
DFFW2018location not on record	3
Bavarian State Collection of Zoologylocation not on record	2
Philadelphia, US	2
McGill University, Lyman Entomological Museumlocation not on record	1
BioFokuslocation not on record	1
KwaZulu-Natal Museumlocation not on record	1
San Francisco, US	1
DFlocation not on record	1
University of Guelphlocation not on record	1
CIBIOlocation not on record	1
Natural History Museum, Londonlocation not on record	1
CUlocation not on record	1
California Department for Food and Agriculturelocation not on record	1
Chicago, US	1
Uniwersytet Łódzkilocation not on record	1

41 institutions · 764 of 1 086 vouchered records shown · 320 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA828 detections

Where the DNA of Musca autumnalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found828

Studies independent surveys5

Countries16

Verifiable raw sequence linked360

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 828 detections have coordinates

Open the map16 countries0

5. Wetlands (inland)ForestUrbanAgricultural fieldfarm1. Forest & Woodland|1.9. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 4.00–17.1

Seasonal swing summer↔winter18.3 °C

Max temp (day)17.0 °C 7.20–22.4

Min temp (night)9.50 °C 0.4–13.4

Precipitation68.3 mm/mo 27.9–94.1

Air humidity61.3 % 54.8–64.1

Moisture balance-17.4 mm/mo -83.1–21.8

Vapour deficit569 Pa 302–828

Wind speed3.50 m/s 2.40–6.40

Cloud cover48.2 % 33.8–58.1

CHELSA 1981–2010, ~9 km grid, at location & month of 686 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Musca autumnalis

At a glance

Sources10 archives

Compound class profile3 classes

Documented compounds6 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type16 853 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 41 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type16 853 records