Musa rubra

Wall. ex Kurz · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Musaceae/Musa

At a glance

Occurrence records18

Data sources12

Biological traits21

DNA specimens9

eDNA detections8

Sources12 archives

Databases and archives Musa rubra's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility18 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF18 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB · GoaT639 Mbp

01Narrative

Musa laterita is an Asian tropical ornamental species of plant in the banana family native to the Indian subcontinent (northeastern India) and Indo-China (Myanmar and Thailand).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology10

Fruit length70 mm

Fruit length max70 mm

Fruit length min70 mm

Fruit width27.5 mm

Fruit width max30 mm

Fruit width min25 mm

Leaf width500 mm

Plant height1.95 m

⚠ sources differ — GIFT: 1.95 m · TRY: 2.4 m

Plant height max2.4 m

Plant height min1.5 m

Life cycle & reproduction3

Life formherbaceous tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatesubtropical

Climberself-supporting

Elevation max1 300 m

Elevation mean1 135 m

Elevation min1 000 m

Epiphyteterrestrial

Woodinessnon-woody

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Musa rubra has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes4

GenBank sequences10

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKJ847175.1 ↗550 bp

ACGT

TGACGAGGACGACCGTGAATGCGTCAACGAATGCTCGTCGGGCTCGTCCCGACAACACCCCGAATGTCGGTTCGCCCTCGGGCGGGACGA …

Musa rubra isolate GXJ543 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK1★rbcL3★ITS6

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Musa rubra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size638 634 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Musa rubra0.64 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records22–222n range22median22mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 224×GoaT · Kew Plant DNA C-values Database · CCDB · eflora · CCDB · book-atlas-flowering-plants +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · eflora

CCDB · book-atlas-flowering-plants — Simmonds & D. 1949 -

CCDB · kew — Bartos J, Alkhimova O, Dolezelova M, De Langhe E, Dolezel J. 2005. Nuclear genome size and genomic distribution of ribosomal DNA in Musa and Ensete (Musaceae): taxonomic implications. Cytogenetic and Genome Research 109: 50-57.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type18 records

Wild obs. + sensor9

Museum / vouchered4

Other5

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 2>10 km 4

6 georeferenced · 3 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	2
Edinburgh, GB	1

2 institutions · 3 of 4 vouchered records shown · 1 without an institution code

09Environmental DNA8 detections

Where the DNA of Musa rubra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.5 °C 24.5–24.5

Seasonal swing summer↔winter11.6 °C

Max temp (day)28.5 °C

Min temp (night)20.2 °C

Precipitation204 mm/mo

Air humidity61.7 %

Moisture balance83.6 mm/mo

Vapour deficit1,173 Pa

Wind speed2.30 m/s

Cloud cover40.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)