Mucuna holtonii

(Kuntze) Moldenke · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Mucuna

At a glance

Occurrence records317

Data sources10

Biological traits14

DNA specimens33

eDNA detections12

Sources10 archives

Databases and archives Mucuna holtonii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility317 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS · NPASS56 compounds

Occurrence & distributionGBIF317 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD · NCBI33 specimens

01Narrative

Mucuna holtonii is a species of plant in the bean family, which is pollinated by bats. Bats are able to detect if the flowers have nectar using echolocation. D. von Helversen and O. von Helversen. "Object recognition by echolocation: a nectar feedingbat exploiting the flowers of a rain forest vine". in Journal of Comp. Physiol. A. (2003) 189: 327-336. von Helversen & von Helversen (1999) Acoustic guide in bat-pollinated flower Nature 398:759-760. After an initial bat visit during which nectar is removed, the petals are arranged in a different manner (altering the shape of the flower). As a result, the unique "echo fingerprint" of petal arrangement informs the bat whether nectar is present or absent. It is thought that the plant evolved acoustically conspicuous structures to make them easier to detect by glossophagine bats.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass6 274 mg

Seed mass max6 274 mg

Seed mass min6 274 mg

Life cycle & reproduction1

Life formliana

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberobligatory

Elevation max2 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formclimber

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition56 compounds

Compounds documented for Mucuna holtonii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Chalcones14

Flavanones11

Flavonols6

Flavones5

Acyl phloroglucinols4

Documented compounds56 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Alpinetin	present	NPASS
(-)-Nicolaioidesin B	present	NPASS
(-)-Pinostrobin	present	NPASS
(2,6-dihydroxy-4-methoxyphenyl)-[(1S,2R,6S)-3-methyl-2-(3-methylbut-2-enyl)-6-phenylcyclohex-3-en-1-yl]methanone	present	NPASS
(2-hydroxy-4,6-dimethoxyphenyl)-[(1R,2S,6R)-3-methyl-2-(3-methylbut-2-enyl)-6-phenylcyclohex-3-en-1-yl]methanone	present	NPASS
(2R)-5-hydroxy-7-methoxy-2-phenyl-2,3-dihydrochromen-4-one	present	NPASS
(2R)-8-[(2E)-3,7-dimethylocta-2,6-dienyl]-5-hydroxy-7-methoxy-2-phenyl-2,3-dihydrochromen-4-one	present	NPASS
(2S)-5,7-dimethoxy-2-phenyl-3,4-dihydro-2H-1-benzopyran-4-one	present	NPASS
(2S)-6-[(2E)-3,7-dimethylocta-2,6-dienyl]-5,7-dihydroxy-2-phenyl-2,3-dihydrochromen-4-one	present	NPASS
(2S)-6-Geranylpinostrobin	present	NPASS

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mucuna holtonii has left across the world's sequence archives.

At a glance

DNA specimens33

Marker genes5

GenBank sequences10

eDNA detections12

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKT696044.1 ↗680 bpColombia

ACGT

CTCACAACAAGTTCAACCGGTGAATCTGTTTATCATCCACCCTGACCGGGGCTAGGTCGGGGTTGTTGTTGTTCTGGAACACCTACCTCG …

Mucuna holtonii voucher W. Devia et al. 2302 (MO) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL8★rbcLa★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type317 records

Wild obs. + sensor31

Museum / vouchered285

Other1

Range

Area of Occupancy AOO708 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 5≤1 km 4≤10 km 3

12 georeferenced · 19 without coordinates

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 7≤1 km 8≤10 km 16>10 km 3

34 georeferenced · 251 without coordinates

Open the institutions mapphysical evidence285

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	70
Saint Louis, US	66
Mexico City, MX	20
Universidad de Antioquia (UdeA)location not on record	18
Museo Nacional de Costa Rica (MNCR)location not on record	15
San José, CR	12
Area de Conservacion Guanacastelocation not on record	11
Tuxtla Gutiérrez, MX	8
Kew, GB	8
Universidad Nacional de Colombia (UNAL)location not on record	5
Chicago, US	5
Provincia di Livornolocation not on record	5
South Kensington, GB	4
Antiguo Cuscatlán, SV	3
HUAlocation not on record	3
Berlin, DE	3
OTSlocation not on record	2
Durham, US	2
Miami, US	2
Montréal, CA	2
University of Stellenboschlocation not on record	2
Mérida, MX	2
Chapingo, MX	1
Paris, FR	1
Ann Arbor, US	1
LDlocation not on record	1
Xiamen, CN	1
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1
San Francisco, US	1
ASUlocation not on record	1

30 institutions · 276 of 285 vouchered records shown · 9 without an institution code

09Environmental DNA12 detections

Where the DNA of Mucuna holtonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 24.1–25.7

Seasonal swing summer↔winter2.30 °C

Max temp (day)28.2 °C 26.7–29.2

Min temp (night)21.9 °C 21.1–22.5

Precipitation58.6 mm/mo 44.2–468

Air humidity65.5 % 61.2–75.5

Moisture balance-87.3 mm/mo -102–334

Vapour deficit1,051 Pa 730–1,275

Wind speed2.00 m/s 1.30–2.30

Cloud cover22.4 % 13.6–34.2

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)