Mucidosphaerium pulchellum

Plantae/Chlorophyta/Trebouxiophyceae/Chlorellales/Chlorellaceae/Mucidosphaerium

At a glance

Occurrence records4 224

Data sources6

Biological traits1

DNA specimens2

eDNA detections2

Sources6 archives

Databases and archives Mucidosphaerium pulchellum's data was compiled from.

GBIFGlobal Biodiversity Information Facility4 224 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF4 224 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat freshwateryes

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mucidosphaerium pulchellum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences7

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY323469.1 ↗242 bp

ACGT

ACACCCTCGCCCTCCCTCCCCTTGTGGGTTGGAGCGCGGACCTGGCCTTCCCGGCTCGGCTGCTATCTTAGCGGCTCCGGGTTGGCTGAA …

Mucidosphaerium pulchellum strain SAG 222-2a internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1ITS6

plant barcodefungal barcode

08Occurrence & distribution

Record type4 224 records

Wild obs. + sensor145

Museum / vouchered4 046

Other33

Range

Area of Occupancy AOO1 020 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 69≤1 km 6

75 georeferenced · 70 without coordinates

Open the mapobservation + sensor145

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 92≤1 km 20≤10 km 4

116 georeferenced · 3 930 without coordinates

Open the institutions mapphysical evidence4 046

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
730location not on record	3 836
UniRosZSlocation not on record	90
TÜ_EMIlocation not on record	9
Ieva Bardalocation not on record	4
IPA/SPlocation not on record	2
University of Hawaii at Manoalocation not on record	1
McWane Science Centerlocation not on record	1
National Marine Biodiversity Institute of Korealocation not on record	1
Trondheim, NO	1
Minia, EG	1
Lake Charles, US	1

11 institutions · 3 947 of 4 046 vouchered records shown · 99 without an institution code

09Environmental DNA2 detections

Where the DNA of Mucidosphaerium pulchellum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

Mucidosphaerium pulchellum

At a glance

Sources6 archives

Habitat & environment1

At a glance

Record type4 224 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type4 224 records