Morchella exuberans

Clowez, Hugh Sm. & S.Sm. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Pezizomycetes/Pezizales/Morchellaceae/Morchella

At a glance

Occurrence records77

Data sources7

Biological traits0

DNA specimens5

eDNA detections12

Sources7 archives

Databases and archives Morchella exuberans's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility77 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF77 records

Environmental DNA2 datasets · 2 countries12 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Morchella capitata is a later synonym of Morchella exuberans. Originally identified as phylogenetic species Mel-9, it was described as new to science in 2012 by Kuo and colleagues. In 2014 however, Richard and colleagues clarified the taxonomic status of this species, retaining the name Morchella exuberans of Clowez (2012) over M. capitata. It is a cosmopolitan, post-fire fungus in the family Morchellaceae, shown to occur in at least three continents, and is one of four species of fire-adapted morels in western North America (the others being M. eximia, M. sextelata, and M. tomentosa). It has also been found in Turkey, Sweden, China and Cyprus, but remains unclear whether dispersal between these distant locations occurred naturally or through accidental introduction by humans.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Morchella exuberans has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes2

GenBank sequences10

eDNA detections12

Countries4

The DNA barcodea real sequence read deposited for this species

ITSOK047533.1 ↗660 bp

ACGT

CGGAAGGATCATTACCAAGAACCACACAGAAAAGGGAGGCAAAGGGGCCGACAGGATTAAGTAGCTTTTACGTTGTTGAACGTCCTGGCT …

Morchella exuberans strain M21-HZ17 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type77 records

Wild obs. + sensor56

Museum / vouchered21

Range

Area of Occupancy AOO204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy18% within 1 km

≤100 m 6≤1 km 3≤10 km 4>10 km 38

51 georeferenced · 5 without coordinates

Open the mapobservation + sensor56

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 2

6 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Olocation not on record	4
TENN-Flocation not on record	3
Kenai National Wildlife Refugelocation not on record	3
DOI/FWS, Kenai National Wildlife Refugelocation not on record	2
ILLSlocation not on record	2
University of Oslo, Natural History Museumlocation not on record	1
nsnflocation not on record	1
SLU Artdatabankenlocation not on record	1

8 institutions · 17 of 21 vouchered records shown · 4 without an institution code

09Environmental DNA12 detections

Where the DNA of Morchella exuberans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys2

Countries2

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

Burned pine forest (burned july 2018)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 9.60–15.2

Seasonal swing summer↔winter23.6 °C

Max temp (day)18.4 °C 12.8–18.9

Min temp (night)10.2 °C 4.30–11.4

Precipitation67.3 mm/mo 42.4–81.7

Air humidity60.3 % 58.3–60.9

Moisture balance-44.2 mm/mo -60.7–-28.6

Vapour deficit672 Pa 497–685

Wind speed4.00 m/s 2.20–4.20

Cloud cover45.0 % 40.6–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)