Morchella eximia

Boud. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Pezizomycetes/Pezizales/Morchellaceae/Morchella

At a glance

Occurrence records117

Data sources8

Biological traits0

DNA specimens8

eDNA detections8

Sources8 archives

Databases and archives Morchella eximia's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility117 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF117 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceNCBI≈73 Mbp

01Narrative

Morchella eximia is a globally-occurring fungus in the family Morchellaceae (Ascomycota), first described by Émile Boudier in 1910.Boudier E. (1910). Icones mycologicae ou iconographie des champignons de France principalement discomycètes avec texte descriptif. Tome II, pl. 194–421. Librairie des Sciences Naturelles, Paris. In an elaborate phylogenetic and nomenclatural revision of the genus in 2014, Richard and colleagues showed that the taxa Morchella anthracophila, Morchella carbonaria, and Morchella septimelata, proposed in 2012 by Clowez and Kuo et al. respectively, are all later synonyms of this old taxon. Morchella eximia is a fire-associated species, growing abundantly in recently burned forests.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Morchella eximia has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes2

GenBank sequences10

eDNA detections8

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPV796461.1 ↗352 bpItaly · 2021

ACGT

ACGTCAGAATCATAACAAAAAAAAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCCACATCGATGAAGAACGCAGCGAAATGCGATA …

Morchella eximia strain Mor_05 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

06Genome at a glanceNCBI

The complete instruction manual Morchella eximia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈73 461 028 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Morchella eximia0.07 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type117 records

Wild obs. + sensor83

Museum / vouchered34

Range

Area of Occupancy AOO364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 14≤1 km 5≤10 km 16>10 km 41

76 georeferenced · 7 without coordinates

Open the mapobservation + sensor83

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 4≤1 km 1≤10 km 5>10 km 1

11 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uppsala, SE	4
DOI/FWS, Kenai National Wildlife Refugelocation not on record	3
Kenai National Wildlife Refugelocation not on record	3
Ann Arbor, US	2
Kensington, AU	2
California State University, East Baylocation not on record	2
San Sebastián, ES	1
Museo Entomologico de Leonlocation not on record	1

8 institutions · 18 of 34 vouchered records shown · 16 without an institution code

09Environmental DNA8 detections

Where the DNA of Morchella eximia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 7.60–13.1

Seasonal swing summer↔winter23.6 °C

Max temp (day)16.6 °C 10.6–16.6

Min temp (night)8.20 °C 2.40–10.5

Precipitation31.7 mm/mo 22.0–38.7

Air humidity59.7 % 59.2–63.0

Moisture balance-72.6 mm/mo -114–-67.7

Vapour deficit558 Pa 422–586

Wind speed4.30 m/s 1.40–4.40

Cloud cover40.7 % 39.2–42.1

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)